Unigene SGN-U269545

Unigene Basic Information 
Unigene ID: SGN-U269545
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269545
mRNA sequence: Length: 1424 bp

>SGN-U269545 Solanum tuberosum #4 (33 members)
TTGCATTTAGCTGTAGACTCATCTTCTTTAAAGCACTATTTTATTTTCTTTGATTCTGTGGTCTGTAAATCATGGCTACACAAGGTCAAG
TCATCACCTGCAAAGCTGCGGTGGCCTGGGAACCCAACAAGCCTTTGGTGATTGAGGATGTGCAGGTGGCTCCACCGCAAGCCGGTGAAG
TTCGGGTTAAAGTTTTGTATACTGCTCTCTGCCATACCGATGCTTATACCTGGAGTGGCAAGGATCCTGAGGGTCTCTTTCCATGTGTTC
TTGGTCATGAGGCTGCAGGGATAGTAGAAAGTGTTGGTGAGGGAGTGACTGAGGTTCAGCCAGGAGACCATGTTATACCTTGCTACCAGG
CAGAATGCAGAGAATGCAAGTTCTGCAAATCAGGAAAGACCAATCTTTGTGGTAAAGTAAGGGCTGCTACTGGAGTGGGAGTTATGATGA
ACGACCGCAAGAGTCGATTTTCTATCAATGGAAAACCGATCTATCATTTCATGGGAACTTCAACCTTCAGTCAGTACACTGTTGTCCATG
ATGTTAGTGTTGCAAAGATTGACCCAGCAGCTCCTCTGGAGAAAGTCTGCCTTCTCGGGTGTGGTGTTCCAACTGGCCTTGGAGCTGTTT
GGAACACTGCAAAAGTTGAACCCGGTTCCATTGTTGCCGTCTTTGGCCTGGGAACAGTTGGTCTTGCTGTGGCGGAGGGTGCAAAAGCTG
CTGGTGCTTCACGAATTATTGGAATTGATATTGACAGCAAAAAGTTCGATAGAGCCAAAAATTTTGGTGTGACTGAATTCATCAATCCCA
AGGAGCATGAGCAACCCATTCAGCAAGTCATTGTGGATCTTACAGATGGTGGTGTTGATTACAGTTTTGAGTGCATAGGAAATGTCTCTG
TTATGAGGGCTGCTTTAGAGTGTTGTCACAAGGGTTGGGGAACCTCAGTGATTGTAGGTGTTGCTGCTTCTGGTCAGGAGATATCTACAC
GTCCATTTCAGCTGGTAACTGGTCGTGTTTGGAAGGGAACTGCTTTTGGTGGTTTCAAAAGCCGATCACAAGTTCCTTCCCTCGTGGACA
AGTATTTAAAGAAGGAAATCAAGGTGGATGAATACATCACTCATAGCATGACACTTGCGGACATAAACAAAGCTTTTGACCTGATGCATG
ACGGGGACTGCCTCCGTGTTGTCCTGGATATGTTTGTATGAACGAAGTCTGGAGGCACTTTATGTTGCTGACTTTCTGTTTTTGTGCTAT
TTATCGGACACTATTTCCCTTTCCCCTTCCCCTTCCTAATTGTATGTGTGGAATAAAAAGAAAGTAAGAAAAAAAGGATCCATGGGACGG
ATGAACTCTTTTTAAATGGGGATGCTATTTTATTATCTTTTCAACTAAAAAAAAAAAAAAAAAAAACTCGAGAC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ268847 alcohol dehydrogenase class 3alcohol dehydrogenase
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (33)  
Alignment image suppressed for unigene with 33 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)