Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Unigene SGN-U269701

Unigene Basic Information 
Unigene ID: SGN-U269701
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269701
mRNA sequence: Length: 1814 bp

>SGN-U269701 Solanum tuberosum #4 (23 members)
AAATTTATCAACAACTACTCCCACTAACATAAACAATTCAACAACTTGTGGAAACTTGACACAGCTAATCCATGGCAGCTCGTAGACTTT
CTTCTTTACTCTCTCGTTCTCTCCACCTTCCTTCTGCTTCTGCTTCTCTTCTAGGAAGAAGCCATGGTGTGGCAAGGCACATCAACAGGT
TTAGTACAGCTGCAGCTGTTGAGGAATTAATCACTCCACCTGTCCAAGTTAATCACACCAAGCTTCTAATCAATGGACAATTTGTTGATT
CTGCATCTGGAAAAACGTTCCCAACTTTGGATCCAAGAACTGGGGAAGTCATAGCAAATGTTGCTGAAGGTGATCTCGAAGATGTTAATC
GCGCTGTGGCTGCTGCTCGCAAGGCATTTGACGAGGGACCATGGCCCAAAATGAGTGCTTATGAAAGGTCACGGATAATGCTAAAGTTTG
CTGATTTGGTGGAGAAACACAATGATGAGATTGCAGCTTTAGAAACATGGGATAATGGCAAGCCATATTTGCAGGCTGCCCAAGCTGAAG
TACCTTCTTTTGTGCGATTATTTCGGTACTATGCTGGTTGGGCGGATAAAATCCATGGTCTAACTGTTCCAGCTGATGGGCCATACCATG
TACAAACTTTACATGAACCAATTGGGGTTGCTGGTCAAATAATTCCATGGAACTTTCCCCTTCTTATGATGGCCTGGAAAGTTGGGCCTG
CCCTAGCATGCGGTAACACTATTGTCCTGAAGACTGCTGAGCAAACTCCACTGACTGCTCTTTATGTTGCAAACTTATTCCATGAGGCTG
GTCTTCCTCCAGGTGTTTTAAATATTGTTTCTGGTTTCGGACCTACCGCTGGTGCTGCACTTGCTAGTCATATGGATGTAGACAAGCTTG
CTTTCACTGGATCAACGGAAACTGGACAAACAGTTCTTCAACTGGCTGCCAAAAGCAATCTGAAACCAGTTACCCTCGAACTAGGAGGGA
AATCACCTTTCATTATATGTGAGGATGCTGACGTTGATCATGCTGTTGAGCTAGCACATTTTGCACTCTTCTTTAATCAGGGCCAATGTT
GTTGTGCTGGTTCTCGTACCTATGTACATGAACGAGTATATGATGAATTTGTAGAGAAGGCAAAGGCACGTGCAATGAGACGTGTAGTTG
GTGATCCCTTCAAGAAAGGTGTTGAACAAGGTCCTCAGATCGACTCGGAGCAATTTAAGAAGATTCTTAGGTACATAAGAGAAGGCCGTG
ACAGCTCTGCCACCCTTGAATGTGGTGGTGATAGAATTGGCTCCAAAGGCTACTTTATTCAGCCCACTGTGTTCTCAAATGTCAAGGAGG
ACATGTCGATAGCACAGGATGAGATTTTTGGTCCAGTGCAATGTGTCTTCAAATTCAAGGATATTGGTGAAGTAATAAAGAGAGCAAACA
ACACTCGCTATGGTCTAGCAGCAGGCGTTTTCACAAAGAACATCGACACAGCAAACACCTTGACCCGAGGATTGAGAGCTGGAACGGTGT
GGATTAACTGCTATGATATATTTGATGCTGGAATTCCTTTTGGAGGGTACAAGATGAGTGGCACGGGCAGGGAAAAGGGTATTTACAGCC
TTAACAACTACTTACAGGTGAAGGCTGTTGTTACTCCATTGAAGAATCCGGCTTGGATATAAGATTTGCCACCCCTGATTTTAAATCATA
CTACTGTTTTTGTAAAATGGTGCACATGGGTTTGTTTACATGACAATGTTGTTATCAATTACAATAAAGTCTTCAGATTGTTCATTAAAA
AAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (14)  
mRNA member sequences (23)  
Alignment image suppressed for unigene with 23 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)