Unigene SGN-U269760

Unigene Basic Information 
Unigene ID: SGN-U269760
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269760
mRNA sequence: Length: 1014 bp

>SGN-U269760 Solanum tuberosum #4 (3 members)
ATTAAACTAGTCAAAGCTGACAATTTTCAAAGGTGTTTTGGTAGACATTTTTCTAACACTGAAACTCCAACTACCAACTCCATTGTTGAT
GCTTCATTAGCTGTTCCCATTTCAGCTTCATCCATGGAATCCGATAACTCAAAGAAGAAGGCAACTGATTCAACATGGGTTTCGAAGATT
GTATTGTATTCTTTCTGGCAAAGTTCATGTTCTTGGAGAGTTCGCTTCGCCTTAAATCTCAAAGGTCTTTCTTATGAATATAGAGCAGTC
AACCTTGGCAAAGGAGAACAGTTCACTTCAGGTATTATGTTTGATTTTTTTTATAGTCATTCACATGTATGGAATTCAGAAGTACCAAAG
GCTTTTCTTGAGGGCAATACTCAATGGCAGAGGGAGGATTTTCATCAAGGGGGTTCAAAAAAAATTAATCACGTAAATAATATCCACAAA
TAAACGGGTCGGATTAAACGGTCGAATCAAGAAGAAACGGATTTTTTAATATTTGACTTTATAATTAGGGATTAAACTAATAAATCCTAA
ATTCCCAATCAGCGTTTTAATTTTTTGGAACTAAACATCATTTTCTGATTGCATTATTATTTATTTTCAAAAAATAAAACGCCTGAAATA
TGCTGATAAAACAAAATGCCTCTGTCCGGATTCGAACACGCGACATCGCATGCAGTAGAGCAAATTCCTGAACCCCCAACGCCACTGAGC
TACGCCTTTGGTGTATGTTCAGGGGGTTCAATAGTATATATATACACATATATTCAAAATTTAATCTTAGTGTAATTTTTCGACTCATTC
AACGTACATCCGCCCCTGGCAATACTGTGTTGATAAAAGAAGATTTCCCATAGAAATTACTATAACTCCAGCCAAGAAAGCTATTCTTGT
GGTGTGGGCGAGATGTCTCTGCAGATTTTTAAATAGAAATAATGGTGTGTCGGACAGTCTGAAGATTGGCTAATCTAGCTCCTATCTGCT
TAATTAGACATAGAGATAGTAGTT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
ds2 ds2
tcp1 tcp1 gene for putative transcription factortranscription factor
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (4)  
Preceding Unigenes (1)