Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U269935

Unigene Basic Information 
Unigene ID: SGN-U269935
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 269935
mRNA sequence: Length: 1261 bp

>SGN-U269935 Solanum tuberosum #4 (26 members)
GATCCTGCACAGGAATTAAGAGCTTTGAAGTGTGAGTGAGAAATATAGTATAATAGAAAGATGGAGACTTTCCCAGTGGTTAACATGGAG
ATGCTTAACACTGAAAAAAGGGCTGCAATATTGGAGAAAATAAAAGATGCTTGTGAGAACTGGGGATTCTTTGAGGTGATTTATCATGGG
ATCTCTCATGATCTTATGGACACAGTGGAGAAGTTCACAAAGGAACATTACAAGAAGTGTATGGAACAAAGATTCAAGGAAATGGTGGCA
AGTAAAGGCCTTGAAGCTGTTCAGACTGAAATTGATGATTTGGACTGGGAAAGTACTTTCTTCTTGAAACATCTTCCTGTTTCAAACATT
TCAGAAGTTCCTGATCTTGAAGATGATTACAGGAAAATCATGAAGGAGTTTGCTGATAAACTGGAGAAACTAGCAGAGCAACTGTTGGAC
TTGCTGTGTGAAAATCTAGGACTAGAGCAAGGTTACTTGAAGAAAGTGTTTTATGGTTCAAAGGGTCCTACTTTTGGCACCAAAGTTAGC
AACTACCCACCATGTCCCAAGCCTGATCTCATTAAAGGCCTGAGGGCTCACACAGATGCTGGTGGCATCATCCTTCTATTCCAAGATGAC
AAAGTCAGTGGTCTCCAACTACTCAAAGATGGCAAATGGATTGATGTTCCACCAATGCGCCACTCCATTGTCATCAACCTCGGTGACCAA
CTCGAGGTGATTACCAATGGAAAATACAAGAGTGTGGAGCACAGGGTGATTGCTCAGCCTGATGGAAACAGAATGTCCTTGGCTTCGTTC
TATAATCCGGGGAGTGATGCTGTCATCTATCCAGCACCAGAATTGTTGGAGAAGGAAGAAAAAGAGAACACAGTAATGTATCCCAAATTT
GTTTTTGAGGACTATATGAAATTATATGCAGGTCTCAAATTCCAAGCTAAGGAGCCAAGGTTTGAAGCAATGAAGGCTGTGGAAACTGCT
GTCAACTTGGGCCCAATAGCAACTGTTTGATGAGACCAGTCAGTATTAATACAACACTAATTAATGGGAATGGGAATGGGAAGAAAAGAT
TGTTTAGTACTAAGATAATGATGTTGTAATAATTTGTTAATGTTGGTTTAATTAGTGGGATGCTTTGTGCAACTTGGGTTTTCTTTATGT
ACTCTTGTCTGGTAGTGTGATGTCTTAAGAGGAGTTTATTGTGAAGTTTTCAGATTTCCAATGAAATCTTTTATTCCCAGCAAAAAAAAA
A


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
aco2 1-aminocyclopropane-1-carboxylate oxidase 2carboxylate oxidase
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (26)  
Alignment image suppressed for unigene with 26 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)