Unigene SGN-U270047

Unigene Basic Information 
Unigene ID: SGN-U270047
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 270047
mRNA sequence: Length: 1252 bp

>SGN-U270047 Solanum tuberosum #4 (21 members)
CCGAATGGAATCTTGATTTTGTGGAGAACTGTGAGCAGGGNAGATAGGTATCANGGAACTANGCTCACAGGGGTTTGATGAAAGCCCTTT
AAGGATTTCATTGGGCTTGCTTGCTTGGACCTTCACAGGTTGGAAACCAACCCTTAATTCCATTGTTCAACAAACTTGATTTCCTGGACC
ATTCCCACGAGTGCTTGCTTCTTCCTTATGAACAAGCACTTACAAGGGAGGATTCAACTTCTGGTCTTTTCTATGATTGTTCTGCTCACA
TGGTATGGGTTGGGGAAAGAACCAGGCAACTAGACGGTGCTCATGTCGAGTTTTTGAGAGGAGTTGCAAACCCTCTTGGCATAAAGGTGA
GTCAAAAAATGGATCCAAATGAGCTAATTAAGCTCATTGACATCCTGAACCCTGCCAATAAGCCTGGAAGAATAACTGTAATTGTTAGAA
TGGGTGCTGAGAACATGAGAGTGAAACTTTCCCACTTGGTCAGGGCAGTACGAGGAGCTGGTCAGATTGTGACATGGGTTTGTGATCCAA
TGCACGGGAATACCATCAAGGCACCATGTGGACTCAAAACCCGTGCTTTCGATTCAATCCTGGCTGAGGTCCGAGCTTTCTTCGATGTGC
ATGAGCAAGAAGGAAGCCACCCTGGTGGTATTCACCTAGAAATGACAGGGCAAAATGTGACTGAGTGCATTGGTGGATCACGAACAGTAA
CCTATGACGATTTGGGCTCTCGCTACCACACTCATTGTGACCCAAGATTGAATGCTTCTCAGTCTCTTGAACTTTCCTTCATCGTAGCTG
AGAGACTAAGAAGACGAAGAATGTCCACTCAACGTCTGTAGGCTTATCTAATTTACCTGTACTTTTTTAGTATGGATTCTTGTTCTCTTG
GTATCCAATAACTTATATATGTGGCCTCTGGCCATTTGAGCTGCTGTTTGGATCCAATGTTGAACATGTTACTAATAAACATGGCAGAGC
AACTTGCCTATGAGGTAAATAGGTTTCCTGCAGAGATCAAAGGGGAAATGAACATCAAGTAATTAGTCGATTTATCCGGTATCTGTTCTG
TTTATTTTAGTTTGGACTGTAAGTCTAGGGTATAAGGGTGTTCTTTTTCTTTCCTTGATGTATGAATGATACTTTGAGATACTGGTTTTG
CTGTTTTAGTCTAATGTGTTTGCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
shkb 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)