Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U270104

Unigene Basic Information 
Unigene ID: SGN-U270104
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 270104
mRNA sequence: Length: 1965 bp

>SGN-U270104 Solanum tuberosum #4 (24 members)
GAATAGTCTCAAGTTTCTCTTTTCCCACTTCATCTTCTTCATTCATGACGACTTCTTTCACCGACCTTCTTGCTTCTGATGATTATCCTA
CCAAAGGACTTGGTGATAGAATTGCAGAGAGGACTGGTTCTGGAGTTCCTAAATTCAAGTCTCTTCCACCTCCTTCACTCCCTTTATCTC
CTCCTCCTTTTTCCCCTTCCTCTTACTTTGCTATTCCTCCTGGTTTAAGTCCAACTGAACTTTTAGACTCCCCTGTTCTTTTGTCTTCTT
CAAACCTTCTTCCATCTCCGACAACAGGGAGTTTTCCATCTCATGCTTTTAATTGGAAGAGCAGTAGCCATCAGGATGTGAAACAGGAAG
ACAAAAACTACTCAGATTTTTCTTTCCAGCCTCAAGTAGGGACAGCTGCATCAATCTCTCAATCCCAAACTAACCATGTCCCTTTGGGGC
AGCAAGCATGGAATTATCAAGAGCCCACAAAACAGAATGATCAAAATTCTAATGGAAGATCTGAATTCAACACTACACAGAGTTTTATGC
AGAATAATAATGATCAGAACAATAGTGGAAACCAATACAACCAGAGTATAAGGGAGCAGAAAAGGTCAGATGATGGATACAATTGGAGGA
AATACGGGCAGAAACAAGTAAAAGGTAGTGAAAATCCGAGAAGCTACTACAAGTGTACATACCCAAATTGTCCCACCAAGAAGAAGGTTG
AGAGATCTTTAGATGGCCAAATTACTGAAATTGTGTACAAGGGTAATCACAACCATCCAAAGCCTCAGTCTACCAGAAGGTCGTCGTCAT
CCACAGCTTCATCTGCAATCCAATCTTACAATACACAAACTAATGAAATCCCAGATCATCAATCCTATGGTTCAAATGGCACAGGACAAA
TGGATTCGGTTGCAACACCTGAGAATTCTTCTATTTCATTTGGGGATGATGATCATGAGCACACTTCTCAAAAGAGTAGTAGGTCAAGAG
GAGATGATCTTGATGAAGAGGAACCAGACTCAAAAAGATGGAAAAGAGAAAACGAAAGTGAAGGTCTATCTGCACTAGGAGGGAGTAGGA
CAGTTAGAGAACCTAGAGTTGTAGTTCAAACTACAAGTGATATCGATATCCTAGATGATGGTTATAGATGGAGGAAGTATGGTCAAAAAG
TAGTGAAAGGAAATCCTAATCCCAGGAGCTACTACAAATGCACAAGTACGGGATGTCCAGTAAGAAAACATGTGGAAAGGGCATCACAAG
ACATAAGGTCAGTGATAACAACCTATGAAGGGAAGCACAACCATGATGTTCCAGCAGCAAGGGGCAGTGGCAACCACTCAATTAACCGAC
CTATGGCACCGACCATAAGGCCTACTGTGACATCTCATCAATCCAACTATCAAGTTCCATTGCAAAGTATAAGGCCACAACAGTCTGAAA
TGGGAGCACCCTTTACGCTTGAGATGTTGCAGAGGCCTAATAATTATGGTATCTCAGGATATGCAAATTCAGGGGATTCATACGAAAACC
AAGTTCAGGACAACAATGTGTTTTCGAGAACTAAGGACGAGCCTCGAGATGACATGTTTATGGAGTCATTGCTTTGCTGAAACTGGAATC
CTAGAAAGGAGCACGAATTGAAGTTTATGAAACGAAAAACTGAACCTTTTGTTTTTTTTTTGCATAAAGAATATGATAGGAAGCATTTTG
ATTTCATTTGTTAATAGATCATATACTGTTTATTTTTTTGTGTGTACATTTTGTACTAGGAAATTTGTTTGTTGTAAATTCAATCAAATG
TGGTGTAGAAGTTCATGCAGTTACCACTGTTATGGGGGTTTATTCTTTAGGATAGGAATGTAAATCCCCAACTCATGACTATATGACACT
GATTCTTTATTTCTATCAGATTTTCAAGTTTTATATATTAAAGAAGATTGCAGTTTTTCAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
wrky1 WRKY DNA binding proteinDNA binding
AY615273 WRKY1
pps8 double WRKY type transfactor
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)