Unigene SGN-U270410

Unigene Basic Information 
Unigene ID: SGN-U270410
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 270410
mRNA sequence: Length: 740 bp

>SGN-U270410 Solanum tuberosum #4 (3 members)
TTTTTTTTTATTTTGCATCCTTTGATTTCTCATTTCTTCCCAAAACGAATAAACATCAATAGACTACATTATTAGAGGCTAAGCTATTTC
ATATGTTGCACAAAAAATGAAATGAACTGAGGACTGTCTGCTATTGATCTCAGTGTAGACTTGATTTATACTTTGATATAGGAAATAAAA
TGCTGTCCAGACGCAAACACTGAACCTGTACAGATTGCAGATCTCGTGAATTTTTCTGCTAGCATCTCACAAACTAACTATTCTAACTTT
CTAGCAGCATGGTAAAGCTCCAAATAATCAAGAGCAGGTCGGTTCCAAGACCAATCTTGTTCCATGACCTGCTTGCATAAAGAGTTGAAC
CAATCCCGACCATCGTACCAAGCAGAGAGAGCTCTGAAACGCAGAACTGTAAGTGAGTCCATACATATCAACAAACGAGGAGAAGGGGAA
GGAAGTATGCATCTTAGGGTCTGCATGAGATGGAAAAAAACATGGTGCAAAGAGAAATAATATATCCACCCTTCCCAACATATAAGCAGT
TACAGAAATTCGCTCCAAGTTCCACACTTTATTGTCATTTCCAATAACAATGCTTATCCACAAGTTTGTTTCTTCATTTTCTACATTTGA
GCAGTTCTATTTTCACAAGCACCAACTATTTGACAGCAAACACACTCCCCCCATGCCTCCCCGTAAAAAGGGTTATAATAACGAATGATC
TCAAGAATGACATGACCAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
sss3 soluble starch synthase 3soluble starch synthase
X95759 X95759 starch synthasestarch synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (4)  
Preceding Unigenes (0)None