Unigene SGN-U270448

Unigene Basic Information 
Unigene ID: SGN-U270448
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 270448
mRNA sequence: Length: 997 bp

>SGN-U270448 Solanum tuberosum #4 (20 members)
GTCATTGTTAATTTCCTCATCGTCTCTTTCTTTCTCTCTCTAAGCGTCAATGGCGTCCTCGAATTTCGCGCTTCTACTTCTCGCTTTCTC
TCTCCTCGCCGTCTCCGCCGTCGCCCGGCCATGCAAAACCCTATTCTTCATCACCTCCACTTCCTATTACCAGATCCCCACAACTATTTC
TCGAAACCCTAACCCTAACTCCAATTTCTTCCTCCGTAACCCCTCTATTTCTCCTCGATTCCGTGCTTTCGTCGTCACTACCTCCGGTTT
CCGTGATGATGCTCCGAAATTCGGACTTCTTAGGCCATCAGTTTTCTTCCGAAGATCCGACCCGTTTTTAATCCGTGGACCCGACCCGGT
TTTCTTCGAACGAGAGGACGCTGTTGAACATGTGGAAGATGGAGAGGAATTGGAGAGCCGATCTTCGTCGATGATGCCGGTGGAATTTTA
CTCGTCGGTGACGAGCTCAATCCGTGATCGGACCAAGGATATTATGAGGGTTGTTGGAGCTTTGCTTTTCGGTGTCGGTTGTGGTGCGTT
AACTGCTGCGACTATGTATTTGATCTGGTCGCTTTTCTGGCCTAATCGCTTCGAGGTTGAGGATTCTGATGATGATTTCGAGGACGGTAA
TGGTGATTATGATGTTAGCAGTGCTAAGAAGATGGGGTACGTGGCGATTCCGACTAAAGTTGTGGATGATGATTTGAAGAAGCCTGCTGC
TCCGGCTAAGGAAGTGGTATGAAAGGTGGTCTCTATGTGTAAGTGTTCGGTTAATAGGGGAAAGTTTAATCATTTCTGCTGTTTGTTGAA
TGCATTTGTTATTGATGCTTCAAAATTTGATGAACAAATGTGTTGAATTACTGTGACTTTGCTTTTGTTTATATTAGCATTGAAATGTGA
AGAATATTACTAAATAACTGTAAACAGCGTAATGGAGGAGTGCACCCTCCATGTTATTCCATCGAACAAATATGACAATTATGATGGTTT
CTATGTT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (13)  
mRNA member sequences (20)  
Alignment image suppressed for unigene with 20 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)