Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U270643

Unigene Basic Information 
Unigene ID: SGN-U270643
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 270643
mRNA sequence: Length: 910 bp

>SGN-U270643 Solanum tuberosum #4 (19 members)
CACGAGGATTTGTACAAATCTCCTCATCTCTCTCACAACTCACACACATAGCAGGACTACAGTGAAGCCGGCGGCAAAGAAAACTGAGGA
AGTGAGAAATGCCTGGGATTAGAGGGCCTTCCGATTATTTGCGAGAACCCCCTCGCCATCCTTGCCTTAAAATTAACGCCAAGGAACCTT
TTAATGCCGAGCCAACTCGTTCAGCTCTGATTTCATCTTATGTCACTCCTGTTGATTTCTTCTACAAGAGAAACCACGGACCCATACCAG
TAGTGGATGACATAGAGAGGTATTCCGTTTCTCTGAGTGGTCTTATTAAAAATTCCAAAGACTTGTTTATGAAGGATATTTGTAAGCTTC
CAAAATATACCGTTACTGCCACTTTACAGTGTGCTGGTAACAGAAGAACTGCTATGAGCAAGAGTCGAACGGTGAAAGGAGTTGGTTGGG
ATATTGCTGCTTTAGGAAATGCTGTTTGGGGTGGAGCAAAATTGGCAGATGTTCTTGAATTAGTTGGAATACCTTATTTGACAAGTATCA
CACAATCTGGAGGAAAACATGTTGAATTCGTGAGCATTGACAAGTGTAAGGAGGAAAATGGAGGTCCTTATAAGGCATCAATTCCATTGA
GTCAGGCTACAAACCCTGAAGCTGATGTTCTGCTCGCTTATGAGATGAATGGAGAGCCACTTAATAGGGATCATGGCTATCCACTGCGTG
TGGTTGTCCCTGGTGTGATAGGTGCCCGTTCAGTTAAGTGGCTTGATTACATCAATATCATTGCCGAAGAATGCCAGGGATTCTTTATGC
AAAAAGACTACAAGATGTTTCCACCAACAGTGAACTGGGATAACATCAACTGGTCTACTANGAGACCGCAGATGGACTTCCCTGTTCAGA
GCGCAATATG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ284487 sulfite oxidasesulfite oxidase
Genomic locations (0)None
Library representation (8)  
mRNA member sequences (19)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)