Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

Unigene SGN-U271297

Unigene Basic Information 
Unigene ID: SGN-U271297
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 271297
mRNA sequence: Length: 915 bp

>SGN-U271297 Solanum tuberosum #4 (15 members)
CAGAAACGATGATGTTACAATCAATGGCTCTCAATTCCTTATCTTCTTCTTCTTCTCTTGTTGGAGTTAATAAGGAGCTTCATTCTTCAA
GAACCTCATCTGCAAGATTTCAAGTAAATTCGTCGACAATTCGTTGTTGTTCAAGAAGTCATGCTTACATACCCAAGCTCGAGCCTTTTA
GCAGAACCAAGTTTGATAGAGTTGTTAAAGACCCCCCTTTGATTGAAAAATCAGAAAATGAACTTGCGGATTATTGTTCTGTTCTAGACG
GAGATGATTCTTATAGCTGCTGGCAAGCCTATTTTGAACTCAAAGATCTTGAAAAAGAAGCATCTAAGGAGGAGGTAGAGAGGCTAATAC
TTCAAGCAGGGGGAGTAAAAACTCTCATTGGCTGCTTACATGGAGTTTCAGACATGCACAAAGCCAAAAAGGAAAGCAAAGAATCAGCCA
AAGCTGTTAATCTTGATGCACAACGGGCAAGAGGAACTTGTCCTATACCAGATGGATTGCCAAAGTCGAGAGAAGAGCTTGAGGAAGAGG
AGAAAGCTAGAATGCCAGATTCACCCTATACCAAACTGCTCAGAGCCAAAGGAACACACCCTGTGTGGTACTCGACTACACTTGACTACT
GATATGGAGGGAGTTTCATAAAAAGAACGCTCTTTTGGAGCTTCAGATAATAAGGTCAAGCAATGGAATTGAATAGTATTCTTGGCCAAT
GTGGTAAAAATTATCTGGTGATGTATGTAATGTTAAGCCTGTGGGGATGTTATCACGTATTTTTGTTAGTGTTAGCATAAAATAGTGTGC
TTTATCGGTAGGTTAGGAGTTGCCATTTGTTCTGAATGTAAATATGGTTTGTTTTTGAAAATTATAATAGCAGTGAAGTTTCTAAATACC
CTTAAAAAAAAAACT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (15)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)