Unigene SGN-U271353

Unigene Basic Information 
Unigene ID: SGN-U271353
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 271353
mRNA sequence: Length: 1877 bp

>SGN-U271353 Solanum tuberosum #4 (3 members)
ATGAATAACTACCAAGAGGAGGACATTGTTCGACCCATAGCTGACTTCTCTCCAAGTCTTTGGGGTGATCGTTTCCATTCATTCTCCCTC
GACAATCAGATTGCTGGAAAATATGCTCAAGAGATCGAAACTTTGAAGGAACAATCAAGAATTATATTATCTGCATCTTATAGAAGAACA
TTGGCTGAGAAATTGGATCTGATAGACATTGTTGAGCGCCTTGGCATTGCTTATCATTTTGAAAAACAAATAGACGATATGTTGGATCAA
ATTTACAAAGCAGATCCTAACTTTGAGGCTCACGAATACAATGATTTACAAACTTTATCCGTTCAATTTCGACTATTGAGACAACATGGT
TACAATATCTCCCCAAAACTTTTTAGCAGATTCCAAGATGCAAAAGGCAAATTTAAAGAATCACTTAGTAACGACATCAAGGGTCTTTTG
AACTTATACGAAGCCTCACATGTAAGGACTCATGGAGAAGATATTTTAGAAGAAGCACTTGCTTTCTCTACTGCTCATCTTGAGTCTGCA
GCTCCACATTTGAAGTCACCACTGAGTAAGCAAGTGACACATGCACTTGCGAAATCTCTTCATAAGAGCATTCCAAGAGTCGAGACACGC
TACTTCATCTCCATCTACGAAGAGGAGGAATTTAAGAATGATGTGTTGCTCCGATTTGCAAAACTGGATTTCAACTTACTCCAGATGTTG
CACAAGCAAGAACTCAGTGAAGTATCAAGGTGGTGGAAAGATTTGGATTTTGTGACAACACTTCCATATGCTAGGGATAGAGCAGCCGAA
TGCTACTTTTGGACAGTGGGAGTGTATGCTGAACCTCAGTACTCTCAGGCTCGTGTCATGTTTGCTAAGACTATAGCAATGATTTCGATA
GTAGATGACACATTTGATGCTTATGGCATTTTAAAAGAACTTGAGGTCTACACCGATGCCATACAGAGGTGGGATATTAGCCAAATTGAT
CGGCTCCCTGATTACATGAAAATCAGTTACAAAGCACTTTTAGATCTCTACAATGATTATGAAATGGAGTTGTCCAAGGATGGTAGATCT
GATGTTGTTCACTACGCGAAAGAAAGAATGAAAGAAATCGTGAGAAACTATTTTGTGGAAGCAAAATGGTTCATTGAAGGATATATGCCG
CCAGTCTCTGAGTATCTTAGCAATGCATTAGCTACCAGCACTTATTACTTGCTTACGACTACATCTTATTTGGGCATGAAGTCTGCTAAC
AAGCAAGATTTTGAATGGTTGGCCAAGAACCCTAAAATTCTTGAGGCTAATGTGACGTTATGCCGAGTCATAGATGACATAGCCACCTAT
GAGGTTGAGAAGGGTAGAGGTCAGATTGCCACTGGAATTGAATGTTACATGAGAGATTATGGTGTATCCACAGAAAAGGCCATGGAAAAA
TTCCAAGAAATGGCTGAGACAGCATGGAAGGATGTAAATGAAGGAATCCTTCGACCAACTCCCGTCTCTACAGAGATTCTCACTCGCATT
CTCAATCTTGCTCGCATTATCGATGTTACTTATAAGCACAATCAAGATGGATACACTCATCCGGAAAAAGTACTAAAACCTCATATTATT
GCGTTGTTGGTGGACTCTATTGAAATTTAAATCATCGATTGTTTTGTACATCTGGGAGCACTTGCTTCCCATCCCCTAAAATTATAAGTA
TTCGATTGATGCCTTGTTCGTATCTATGCTGCTAGGCGCTAGCTAAGATAGGAGTTACTGGAGATACATGTTATAGTGCAGTGCAGTTAA
TTCCTTAATTTATTTTTGTATCATTATTGACATTTTAAATATATATATATATATATATAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
pvs1 vetispiradiene synthase 1vetispiradiene synthase
pvs2 vetispiradiene synthase 2vetispiradiene synthase
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)