Unigene SGN-U271354

Unigene Basic Information 
Unigene ID: SGN-U271354
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 271354
mRNA sequence: Length: 1607 bp

>SGN-U271354 Solanum tuberosum #4 (5 members)
GAGGAGATTGTTCGCCCTGTTGCCAATTTCTCTCCAAGTCTTTGGGGTGATCGTTTCCATTCATTCTCTCTCGACAATCAGGTTGCTGAA
AAGTATGCTCAAGAGATTGAAACTTTGAAGGAACAAACAAGGAGTTTGTTGTCTGCTGCTGCTTGTGGAATAACATTGGCTGAGAAATTG
AATCTGATAGACATTGTTGAGCGCCTTGGCTTAGCTTATCATTTTGAGAAACAAATAGATGATATGTTGGATCAAATTTACAAAGCAGAT
CCCAACTTTGACGCTCATGATTTAAACACTTTATCCCTTCAATTTCGAATATTAAGACAACATGGTTACAATATCTCCCAAAAATTTTTC
AGCAGATTCCAAGATGCGAATGGCAAGTTCAAGGAATCTCTTAGCAACGACATCAGGGGTCTATTGAACTTATACGAAGCTTCACATGTA
AGGACTCATGGAGAAGATATTTTAGAAGAGGCACTTGTTTTCTCCACTGCTCATCTCGAGTCTGCAGCTCCAAATTTGGAGTCACCTCTG
AGTAAGCAAGTGACTCATGCCCTTGAGCAGTCTCTCCATAAGAGCATTCCAAGAGTCGAGACGCGTTACTTCATCACCATCTACGAAGAG
GAGGAATTTAAGAATGATGTGTTGCTTCGATTTGCCAAATTGGATTACAACTTACTCCAGATGTTGCACAAACACGAACTTAGTGAAGTA
TCAAGGTGGTGGAAAGATTTGGATTTTGTGACAACGCTTCCATATGCTAGGGATAGAGCAGTGGAATGTTACTTTTGGACGATGGGAGTG
TATGCTGAACCTCAATACTCTCAGGCTCGTGTCATCCTTGCAAAGACTATAGCAATGATTTCGATAGTAGATGACACATTCGATGCTTAT
GGAATAGTAAAAGAACTTGAGGTCTACACCGATGCCATACAAAGTCAAATTGATCGACTCCCAGAATACATGAAAGTTAGTTTTAAGGCT
CTTTTGGATCTCTATGAAGATTATGAAAAGGAGTTGTCAAAGGATGGCAGATCCGATGTTGTCCACTACGCAAAAGAAAGAATGAAGGAG
ATTGTGAGAAACTATTTTGTAGAAGCAAAGTGGTTCATTGAGGGATATATGCCGCCTGTTTCTGAGTATCTTAGCAATGCATTAGCTACC
AGCACATATTACTTGCTAACTACAACATCCTATTTGGGAGTGAAGTCAGCAACAAAGGAAGATTTTGAATGGTTGGCTACGAACCCTAAA
ATTCTTGAAGCCAATGTGACATTATGCCGAGTTGTTGATGACATAGCAACGTATGAGGTTGAGAAGGGTAGGGGCCAAATCGCAACAGGA
ATTGAGTGTTATATGAGGGATTATGACGTATCAACAGAAGTAGCAATGGAAAAATTCCAAGAGATGGCTGAGATAGCATGGAAGGATGTA
AATGAAGGAATTCTTCGACCAACACCTGTCTCTACAGAAATTCTTACTCGCATTCTCAATCTTGCTCGTATTATAGATGTCACTTACAAG
CACAATCAAGATGGATACACTCATCCCGAAAAAGTTCTAAAACCTCACATCATTGCTTTACTGGTGGACTCCATTGA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
pvs3 vetispiradiene synthase 3vetispiradiene synthase
pvs2 vetispiradiene synthase 2vetispiradiene synthase
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (5)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)