Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U271669

Unigene Basic Information 
Unigene ID: SGN-U271669
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 271669
mRNA sequence: Length: 1087 bp

>SGN-U271669 Solanum tuberosum #4 (6 members)
CAGGACTTGGTCTAAATGAGGAAGTGCAGCCGACCATGGAAACCAATACAAGATTTGCCGACGTTAAGGGTGTTGATGAGGCGAAAGGGG
AGTTGGAAGAAATTGTTCACTATCTCCGAGACCCTAAGCGATTCACTCGTCTTGGTGGCAAGCTCCCAAAAGGAGTATTACTTGTTGGCC
CCCCTGGAACTGGTAAGACCATGTTGGCGAGGGCCATAGCTGGAGAAGCTGGGGTTCCCTTTTTCTCATGCAGTGGCAGTGAGTTTGAAG
AAATGTTTGTTGGTGTCGGAGCTCGCAGAGTGAGAGACCTTTTTGCTGCTGCTAAGAAGCGATCACCATGCATTATATTCATTGATGAGA
TTGATGCCATTGGAGGAAGCCGTAACCCAAAGGATCAGCAATATATGAGGATGACTTTAAATCAATTGCTTGTCGAGCTGGATGGCTTCA
AACAAAATGATGGAATCATTGTGATTGCTGCCACTAATTTTGCTGAGTCACTGGATAAGGCATTGGTGAGACCTGGACGATTTGATCGCA
ACATTGTTGTCCCAAATCCTGATGTTGAAGGGCGGAAGCAGATTTTGGAATCTCACATGTCAAAGATTCTGAAGGCGGATGATGTTGACC
TTATGATCATTGCTCGGGGGACTCCTGGATTTTCTGGTGCAGACCTTGCAAACTTGGTGAATATCGCTGCAGTGAAGGCTGCTATGGATG
GTGCCAAAGCCGTAAGCTTGGCTGATCTAGAGCATGCTAAGGACAAGATCATGATGGGAAGTGAGCGCAAATCAGCTTTTATATCCCAAG
AGTCGAGAAAACTCACAGCATACCATGAAGGTGGTCATGCACTTGTAGCTATTCATACAGATGGGGCTCTTCCTGTGCACAAAGCAACTA
TTGTTCCACGAGGAATGGCTCTTGGTATGGTTGCTCAATTACCTGAAAAGGACGAGACTAGCATCTCCCGTAAGCAGATGCTTGCACGAC
TTGATGTTGCCATGGGTGGGCGAGTTGCTGAAAAGCTCATTTTTGGCGACAGTGAAGTTACTACTGGTCCATCTGATGATCTCAAGCAAG
CAACCAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (6)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)