Unigene SGN-U271899

Unigene Basic Information 
Unigene ID: SGN-U271899
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 271899
mRNA sequence: Length: 1126 bp

>SGN-U271899 Solanum tuberosum #4 (10 members)
ATATTCGAACGCCTTTGCGCCTCTGTAAATCTCCCGTCGTTTCTTCTTTCTCTCTCCGGATCACCGACAGAGAAGAAGAAGAAGAAGGAT
ATACCGATACAGCAATTATTAGGGATTTGTATATTTATTTTATCAGGTAAAATATACATTCACAACTGTTGTTTTCTCCATCTCATACGA
TATTCATTCAGCCATTACTCTTTCTCCGGAATTTGCTTCTCAAACATGTCGTACGCATATCTCTTCAAGTATATTATCATCGGCGATACT
GGAGTTGGAAAGTCATGTCTACTTTTGCAATTTACGGACAAACGGTTTCAACCAGTCCATGACCTGACCATCGGGGTTGAATTTGGGGCT
CGAATGATCACAATCGACAACAAACCAATAAAACTACAGATCTGGGACACGGCTGGTCAAGAATCATTCAGATCCATCACAAGGTCATAT
TACAGAGGGGCTGCGGGCGCATTACTTGTTTATGATATTACAAGGAGGGAAACATTTAATCACCTTGCTAGTTGGTTAGAAGATGCAAGA
CAGCATGCAAATGCAAACATGACCATAATGCTGATTGGGAACAAGTGTGATCTGGCTCATAGAAGGGCTGTAAGCACAGAAGAAGGTGAG
CAGTTTGCCAAAGAAAACGGATTGATATTTATGGAGGCCTCAGCTAAAACAGCTCAGAATGTTGAAGAGGCTTTCATCAAAACAGCCTCA
ACAATCTATAAGAAAATACAGGATGGAGTGTTTGATGTATCGAATGAGTCCTATGGAATAAAAGTTGGATATGGAGGCATTCCCGGACCA
TCAGGTGGAAGAGATGGAGCTGCTTCTCAAGGAGGGGGTTGTTGCACTTGAAAATTTGAAAATCATTCTTCAAACTTGATCACGTTCTCA
TCATCTCTATGCCAGCCGTCATCACGGGTCTTTCCTTCTTATCTTTCAGAGGTCTCTTTGATTTGTTTTAATGATGTTATCTGGGCAAAA
ATAAGCCAAATTCAGTAAATAGTGGACAGTCCATCTTTGTGTGCCCCCGTGTATAAAAGTTGACATTACAAAATGTGAATAGAATTCCTT
ATATCTTGTGTGCTTGTGTGAATGAGAAATATTGAACTACAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
agpb1 ADP-glucose pyrophosphorylase small subunit 1
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (10)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 6 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)