Unigene SGN-U271917

Unigene Basic Information 
Unigene ID: SGN-U271917
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 271917
mRNA sequence: Length: 1704 bp

>SGN-U271917 Solanum tuberosum #4 (7 members)
TTTTTTTGTTTGGACAGGAATAAAAATAATACTATCCCATATTGGGTTAGCTTTGTGCTTACAAAAGAAGCGCCAAACAATTTGGATCCA
CATGGCTATACGCAATTAACTGTCTTTTGCCTATTTGTCATCTCTTTACACAAAAAAGATTTCATTTTTTTGTTTCCCCAATTCCCATTT
CAGGTTGAAGCCAATTTACATCAATCATGGATCGGCTAACCAGTGCTGCACGTCTCATGATAGTCTCAGATCTTGACCATACAATGGTAG
ATCATCACGATTCTGAGAACCTTTCTCTGCTTAGGTTCAATGCTTTATGGGAAGCCAATTATCGTGATAACTCTTTGTTAGTGTTCTCTA
CTGGGAGATCACCTACACTTTACAAGGAATTAAGGAAAGAAAAGCCCATGCTAACCCCAGATATTACAATTATGTCTGTGGGAACTGAAA
TAACATATGGTAACGCTATGGTGCCTGATGATGGTTGGGAAACATTTCTGAATAACAAGTGGGATAGAAAGATAGTAACAGAGGAGACAA
GCAAGTTTCCTGAACTCAGTCTGCAGTCAGAAACAGAGCAGCGACCACACAAGGTCAGTTTCTATGTTCAGAAAGAGAAAGCTCAAGATA
TAATGAAAACTCTTTCCAAGCGCTTGGAAGAACGTGGGCTGGATGTCAAAATAATTTACAGTGGAGGGATGGATCTAGATATATTACCAC
AGGGTGCTGGCAAAGGACAAGCACTTGCATATCTGCTTAAGAAACTGAAGAGCGAGGGAAAATTACCAAGCAACACCCTTGCCTGCGGCG
ACTCCGGGAATGACGCTGAATTATTCAGTATCCCAGATGTGTATGGTGTAATGGTAGCTAATGCGCAGGAGGAATTACTGCAGTGGCATG
CTGCAAATGCAAAAAATAATCCCAAAGTAATTCATGCATCAGAGAGGTGTGCCGCCGGTATCATACAAGCCATTGGTCATTTCAAACTAG
GTCCAAGTACCTCCCCAAGAGACGTTACGGATTTGTCAGATTGCAAGATGGACAACTTTGTTCCTGCCTATGAAGTTGTCAAATTTTACC
TGTTTTTTGAGAAATGGAGGCGTGGAGAAATTGAGCATTCTGAGCATTATCTGTCAAACCTGAAAGCAGTGTGTATACCATCTGGTACTT
TTGTTCACCCATCTGGTGTTGAGAAATCCCTTCAGGAATGTGTAACTTCATTCGGAACATGTCATGCTGACAAGCAGGGGAAACAATATC
GTGTTTGGGTCGATCAAGTTTTACCTTCACAGGTTGGTTCAGACTCATGGTTAGTGAGTTTCAAGAAGTGGGAGCTCTCTGGTGAAGACA
TGCGATGCTGCATAACCACAGTCCTATTAAGTTCAAAGAATAAGACTGTTGCAGACGGGCTCACTTGGACTCACGTACATCAGACATGGC
TGCACGGTGATGCAGCAAGTGACTCCGCAACCTGGTTCTTTTAGATTGTCATCTCAGTGTATTAACTCTGAAAATTCCGCACCCCTTTTA
CCAGTTCACACCCAGAATAAACACAACATACAAACTATAGTTGATAATCAATGTATTAACTTTCTCCTTCTTTGATAATCAATGTATTGC
CATCTAAACCAGTGAAGATGGCTTTATCTTTTGTGTAGTATAAAGAATTATATTAGTATCTAAAAAAAAAAAAAAAAAAACTCG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (7)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)