Unigene SGN-U272395

Unigene Basic Information 
Unigene ID: SGN-U272395
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 272395
mRNA sequence: Length: 719 bp

>SGN-U272395 Solanum tuberosum #4 (3 members)
CTCTCTCTCTCCTCTTTCGTCCGGGCGATCTCCCTGTATTTCATCGCCGAAGTAGGTGGCAATGATAATAGAAAGCTGGATCCATTAAGC
ACCACGTGGATATACGATCATCACTTTTGTTTGTGTTAAAAGTCCAGCCTGTGCCTGATTTGTACTTGAAGGGTCTTCTGAGAAATAGAG
GACCCTTCAGACAAGATTTCTTGAGTTAACTTCGAGCTGTTAACTACAAGACAAGTTTGTTTGCATAGGCGGTCAGGGTAAAGGTGGTCG
GTTTGATAAACATGCCAGCTGTACAAAAGCTTTACAACGCCTGTAAAGCATCACTTTCTACTAATGGACCCATATCAGAAGATGCTCTTG
AGAAAGTCCGTTCCCTCTTAGGTTGGTGTCATAAAAAATTCAATCTCTTTTTAAATCGTACTTAATTGTTGGACACATGTATAGGTTTCA
ATCAACCACGTGATTTAGTTGATTCATTTGGTTTTTGTTCTAGTTTCTCTATTTATATCTAGAAGGAGAGCCTTGGAACAACGGCAAAGT
TGTCTCCGTGTGACTTATAGGACACGGGTCGAGCCATGGAAGCAACATTAGGGTACACAGTCTATATCACACCCCTTGGGGTGTGGCCCT
TNCCCGTACCTTGCGAGAAACGTGGGTGCGTTATTCACCAGGTTGCCCTTTATTTATTTCTACATGTTGGTGAAGGCTGTTTTTTTTTT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (5)  
Preceding Unigenes (1)