Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U272908

Unigene Basic Information 
Unigene ID: SGN-U272908
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 272908
mRNA sequence: Length: 2524 bp

>SGN-U272908 Solanum tuberosum #4 (9 members)
CACAGATTCTCTTCTCCAAAAATAGGGCCCGATGATTAGAGGACCACCACAAATCGTCCAGAAATGTCCAACCGGCATTGTAACAGTTAA
CCGGACCAATATAGTTCCACGAACGCACCGTCACGCTCTTCAAGATCTCCGGCAGCTTCGCCGGCGTGATAGTCTCAGGCTCTTCTCCTC
TGACCAACGGATTCTGAAGTTTTGTACATCGGAGGAGGCGTTCCAACCTAGGTTGGTCGCAGCAGCTAAACTTCAGGAAGAAGCTCCTCA
AATGCTGGACGCTTGCCCTTCATTCAAAGTTTCCCCTGGTCTGGCTCATCCACTAGGAGTATCAGAAACTGAAAGTGGAATAAATTTTGC
AATTTTTTCTCAGCATGCTTCTGCAGTTACACTTTGCATAATTCTTCCAAAGAGTGTTCATGATGGAATGATTGAATTAGCATTGGATCC
ACAGAAGAACCGCACAGGAGACATATGGCACATATGCATTAAGGAGTTGCCCCAAGGGGGTGTCCTTTATGGTTATCGCATTGATGGACC
TCGAAATTGGCATGAAGGGCATCGATTTGACGATAGCATTATTTTGGTTGATCCTTACGCAAAACTAATTGAAGGTCGACGAGTTTTTGG
AGATGAAAGCAATAAAATGTGTAGATTTTTTGGAACTTATGATTTCAATAGCTTGCCTTTTGACTGGGGAGAAAATTACAAGCTTCCAAA
TATACCCGAGAAAGATCTTGTTATATATGAGATGAATGTTCGTGCTTTTACTGCTGATGAAACAAGTAGTTTGGATCAAGATCAACGGGG
AAGTTACCTTGGCTTAATTGAAAAGATACCACATCTTCTCGAGCTTGGTGTCAATGCAGTAGAATTATTGCCTGTTTTTGAGTTTGATGA
ACTGGAATTACAAAGGCGACCTAATCCGAGAGATCACATGATCAATACATGGGGCTACTCAACAATAAACTTTTTTGCTCCAATGAGTCG
ATATGCAAGTTGTGGTGGCGGACCTGTCCGTGCTTCCTGGGAGTTCAAAGAAATGGTCAAGGCCTTGCATGGTGCTGGAATTGAGGTCAT
CTTAGATGTTGTTTATAATCACACAAATGAAGCTGATGATGAAAACCCATATACAACCTCATTCCGAGGAATAGACAACAAGGTTTATTA
CATGGTAGATTTAAACAACAATGCTCAGCTGCTGAATTTCGCTGGATGTGGAAATACTTTTAACTGCAACCATCCTACAGTCATGGAACT
TATACTTGAAAGCTTAAGACACTGGGTCACCGAGTATCATGTCGATGGATTTCGCTTTGATCTTGCTAGTGTTCTTTGCAGAGGGACAGA
TGGTACTCCCATTAATGCTCCCCCCCTTGTTAAGGCCATTTCCAAAGATAATGTATTGTCGAGGTGCAAAATTATTGCTGAGCCATGGGA
TTGTGGAGGCCTATATCTTGTTGGAAAGTTTCCGAACTGGGACCGGTGGGCTGAGTGGAATGGGAAGTACCGCGATGACATCAGGAGATT
TATAAAGGGCGATGCTGGCATGAAAGGAAATTTTGCAACCCGTATCGCAGGTTCAGCGGATCTGTACAGAGTGAACAAGCGAAAGCCGTA
CCACAGTGTCAACTTCGTGATTGCCCATGATGGCTTTACCTTGTATGACCTTGTTTCATACAATAATAAGCACAATGATGCGAACGGTGA
AGGTGGCAATGATGGATGCAATGACAACTTCAGTTGGAATTGTGGAATTGAAGGTGAAACTTCAGATGCAAATATTAACGCACTGCGTTC
ACGGCAAATGAAAAATTTTCATTTGGCACTGATGGTTTCTCAGGGAACACCAATGATGCTTATGGGGGATGAGTATGGGCATACCCGCTA
TGGAAATAATAACAGTTATGGACATGATACCGCCATCAACAATTTCCAGTGGGGACAATTGGAAGCAAGGAAGAATGATCACTTCAGGTT
CTTTTCCAAGATGATAAAGTTTCGACTGTCCCACAATGTTCTTAGAAAAGAAAGCTTCATTGAGAAGAACGACATTACCTGGCTCGAGGA
CAACTGGCACAATGAAGAGAGTAGATTCCTTGCATTTATGCTCCATGATGGGAATGGAGGAGATATTTACTTGGCATTTAATGCACACCA
CTTCTCCATCAAAACAGCAATACCTTCACCACCACGAAATAGAAGTTGGTACCGAGTGGTGGACACTAATCTGAAATCACCAGATGATTT
TGTTACTGAGGGAGTGTCTGGTATCAGTGAAACTTATGATGTTGCGCCGTACTCTGCTATCCTTCTTGAAGCAAAGCAATAATTACCGGG
ACTATGCTGCTTTAGATGTTGTCCATGAGTTATTACAGTATTACCTCCTTCTGGATTGGATAGTTCAAATCGGAATTCAGGCTGTTAGCC
TATAGATGTTTGCAATAAGCAACCAGTTTGTTCAAGCTGCTATTGACAGGTACAAACACCCCATAGTAATAAGATAAACTGAGACCATTG
ATCC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY132998 isoamylase isoform 3isoamylase
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (9)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)