Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Unigene SGN-U273181

Unigene Basic Information 
Unigene ID: SGN-U273181
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 273181
mRNA sequence: Length: 1271 bp

>SGN-U273181 Solanum tuberosum #4 (4 members)
GTTCATCTCTGTACAACAAAAATTCTGTAAATGGAACTTTAGCTTTCTTTCCAGAACCACCTGAGAATATTAACTGCCACACCTTTTCCA
TCAACATGTTCTTTTCCACTTAAATTCTACAAACCCCTTTGCTACCCTTTCTTCTTCTTCTGCCGTGAAGTGTTATGGTCAGAATTATGG
GGATGAAGAAGCCCTTTCTACTTCTCTGGCATATGATGTTCTTGGTGTTGCTCCTAATTGCTCTGCAGATGAGTTGAAATCTGCTTTCAG
GAATAAGGTTAAGAAGTTTCATCCTGATGTAAGGAGAGATGGGAATAGTTCAGATAAAATGATTCGCCGTGTCATTCAAGCCTATGAGAT
GTTGTCCAACTTCACAAAGTCAGAGATAATTGAAAGGGAATGCTTAGATCCATTTGATCAGCCAGAATGTGAAGCATTTGATCTCTTTGT
TAATGAGACTGTTTGTATTGGAAAAGGTTGCCAATTTTCATGTGTTAAGAAAGCACCTCATGCATTCACTTTTTCCTCGTTGACAGGAAC
TGCGCAAGCAACTTCTCAAGGACATGGTGAAGATTACCAAGTCCATCTTGCAGCTGGTCAATGCCCCAGGAGCTGCATACATTATGTTAC
ACCTTCTCAAAGAATAGTTCTTGAAGAGCTACTTGGCAGCATCATGAGCACACCTTATGATACATCAGCAGAAGCAGACTTGCTTTATTC
GCTAATTGTAAAAGCTCGTTTTGAGAACAATCGCTACCAGAAGCCCAAGAAGCAACCTAAGGCCTCAACCAAACATGTAGACTGGTTCTA
AATCTTGAAAGTCCTCATAGAAAACCACCTTATTGTGTGTAGAAACTCGGAATTTGAACAGAGGCTGCCACTTCAAAGGCTATGCAATGC
TGAAGTGATCACATAAACGATGGGGGAAATATTATTTGAGTTGACTGTCAACCTTATGCTATGTTATCGAAGTCCTAAATGGTCTTCACT
CTGCAGCAGCATATGAAACATATGCTGGGCACAACTGTTGGGAAAAACAGCTGCAACTGACTGTCTGAATATTTGGTGATATGAGATTGA
TGTAGATATGGAAAATTTACTTTGTTAAATAAACTATTTATAATATCAATGTATTTTAAACTGTTGTAACAGGCAACCTGCCTTATTTCC
TAGTTTACTAATCCTATTTTTTATGGACGATTACTTGTAATTATCTTTTAAGTGCCCTGATAATATAAAAATTATTTTGCTCTACCAAAA
AAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)