Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U273643

Unigene Basic Information 
Unigene ID: SGN-U273643
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 273643
mRNA sequence: Length: 908 bp

>SGN-U273643 Solanum tuberosum #4 (8 members)
CTAAAACCCATTTTCATCTACATCAATAACATCCAATTTTAACAATTTCTTTATCAATCTCAAAAGGGGAAAAAAATATTTTCTTCGATT
TGAAAAAAAAAAATGAGGGGATTAGAAGAAGAATTCATTCCATCAACACCAGGAAAGTTCAAAGACAAAACGTATTACTCCGGTAACCGG
CAATTTCACCGGTGTTTTGCTTCAACAAGTACAATGTTCTTATGGGCATTGTTTTTATTAGCTTTAACGGCGTCGTATTTGAGTTTTCAG
TCCTTCATGGATTCCGGTACCCGGTATCTCTCCTCCACATGGGGTAGTCTTCATTGGGAGAAACAAGTTCGTGATTCCGCCCAAATCCAC
CGTGTTAACGGCATGTCCGTACTCGTCACCGGCGCTGCCGGTTTCGTCGGATCTCACGTTTCAATCGCATTGAAAAAACGTGGAGACGGT
GTCGTCGGAATTGACAATTTCAACAATTACTATGACCCTTCGTTGAAAAAAGCTCGCAAAAATCTGTTGAATTTGCAAAATGTGTACCTC
ATTGAAGGGGATATTAACGATGTTCATCTGTTAGCAAAGCTATTTGATATCGTAGCGTTTACACACGTTATGCATTTAGCTGCACAAGCT
GGTGTTCGTTACGCCATGGAAAATCCCAAATCTTATGTTCATAGTAATATTGCTGGGCTTGTTACGCTTCTCGAAGCTTGCAAAAATGCA
AACCCTCAACCCGCCATTGTTTGGGCAAGCTCGAGCTCAGTTTACGGGTTAAACGAAAAGGTACCGTTTTCCGAATCGGATCGAACGGAT
CAACCCGTTTCGTTATTAGGCAGCAACGAAAGAAAGCTTGGTGAACGAATTTACACCATACTTATAATCACATTTACGGGTTATCAATAA
CCGGGTTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (8)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)