Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U273670

Unigene Basic Information 
Unigene ID: SGN-U273670
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 273670
mRNA sequence: Length: 753 bp

>SGN-U273670 Solanum tuberosum #4 (8 members)
CACGTCTCCACTTTTACATTCTCAGAAATAGCTCTCATATAATTTACTCTCTAAAATGGAGAATTATGCAACAATATTTCCATCAGCATC
ATCGTCGTCATCTCGTCATGATGAATATATTTCATTAATGAATAGCAAGAGTAGTATCAGTGATGATGCAAAAGAGGAATTATTATTCCA
AGGGAAGAATAAGGCTGGGTTCTTGGGACTAATGGCAAGGATGGAAACTCCAAGAGATATTATTACTAAGAAGGATGAGGTGATCAAATC
GTGTAAGAAGAAAATTAAGAAACCAAGATATGCTTTCCAAACAAGGAGCCAAGTTGATATTCTTGATGATGGTTATAGATGGAGGAAATA
TGGACAAAAGGCTGTCAAAAACAACAAATTCCCAAGGAGCTATTATCGATGCACACATCAAGGATGTAACGTGAAGAAACAAGTACAAAG
ATTATCCAAGGATGAAGAAGTAGTAGTAACTACTTATGAAGGCATGCATTCACATCCCATTGACAAATCTACCGATAACTTTGAGCACAT
TTTGAGTCAGATGCAAATCTATACTTCCTATTAAATATTTTATTTATCTTTCAATGCCTAATAAGGCATGTATCTCATCTCACTATATAT
TAGTTACATGTAAAATAATACTGCAGTGTGTACATGCGTTTTAAACATATATAGATGCAGAAATGTTTTAATTTGTCACTATAAAGATTG
TTTTCAAAAGATAAAAGACCATAGAGCATAGTT


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
wrky1 WRKY DNA binding proteinDNA binding
AY615273 WRKY1
pps8 double WRKY type transfactor
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (8)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)