Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U273860

Unigene Basic Information 
Unigene ID: SGN-U273860
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 273860
mRNA sequence: Length: 773 bp

>SGN-U273860 Solanum tuberosum #4 (6 members)
GGCTCCTCTCTCTCTAGCTCAGGCATTCAGTCGTCGCCCTTTTCAGGCGTATTTGCACCTTCTCCGATCACATTTCCAGCCACTCGTCAA
CGTGTCTCATGCCAGGCCACCTCTCCGGCAACATCTCCTCCTTCGTCCGTTAATGTAAATGCTAGTCAGAAGGACTTTTTGCACATCAGC
GATTTTGACAAATCAACTCTTTTGAACATCTTGGATCGAGCCAAAGAGGTCAAACAGCTTATAAAATCAGGGGAGAGGACATATCTCCCA
TTTAAAGGTAAAACTATGGCGATGATCTTTGCTAAGCCATCCATGAGGACACGGGTTTCCTTTGAGACAGGGTTTTACTTGCTTGGTGGG
CATGCTATATACCTGGGACCAGATGACATACAGATGGGTAAGCGGGAAGAAACTCGTGATATTGCTCGTGTTCTGTCTCGCTATAATGAT
ATCATTATGGCTCGAGTTTTTGCTCATCAGGTACGCTGGTGAGTTTTTCTGTTTTGACTTCTTCCTGGTACATGGTGAGTTTCCTATTTT
GGTTTCTTCCTGGTACATGGTAAAGCACTGCTAACACTCTTGTTTGTGCTAGTTGTCCAGTCGATGCTTCTGTTTCCTCTGTTAAAATCC
TCTCTTCATAGCATTGTCCCTTCTAAGTATTTGGTTGCCCCTTTTAATAAGTTGGAACAATAGTTTTTTGATCTTTTCTGTTGGAGCTGA
ATAGCGGATCCATCTTTTATCTAATATCTTACCAGTAAATACAGTTGAATGAT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (6)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 4 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)