Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U274780

Unigene Basic Information 
Unigene ID: SGN-U274780
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 274780
mRNA sequence: Length: 833 bp

>SGN-U274780 Solanum tuberosum #4 (6 members)
GTCATTGTCCCATATCCACCTAACCAACTTGTTATAATATTCCCCCATCCCCATAAAACCCACAACACAAGTCTCTCTATTTATATATTT
GCTTTCTCCCAAAGATAAGTGAAAATTCGATCAATCGAGAGAATTTATAATATGGGTGTTCTTGATTATTTATCAATTTTTTGCACCGTT
ACAAGTAGAAGACGACGTACCAAAAGGAGACCATTACAGACAGTGGAGATAAAAGTGAAGATGGACTGTGATGGATGTGAAAGAAGAGTC
AAGAACGCAGTTAGACGCATGAAAGGTGTGAAAACAGTGGAAGTGATTAGAAAACAACACAGGGTGATAGTGAGTGGTTATGTTGATCCA
GCGAGAGTGTTGAATAGAATAAAAAGCACTGGAAAAAGAGCAGAAATGTGGCCATATGTTCCATATAATTTGGTGTCTTATCCATACGTA
GCTCAAGCATATGACAAAAAGGCACCTTCTGGTTTTGTTAAAAATGTGCCACAAGCACTAATTACACCTAATGCTACTGAAGAAAGGATT
ACTCATCTTTTTAGTGATGATAATCCCAATGCTTGTTCTATTATGTGATCCAACTTTCAAATTTCTTTCTTGGAGTTTAGGAATATTATT
ATATTATGTACTTGTCCATGTCATTGTAATTAACATCTGGCTAAGGTAGAACTAATAGCTTGAACGATGGAAGCTTTTTTTTTTGTGCTT
TGCTTGAATTTGAAGAAGCAAATATCTATTATTGTATACCATCTTTTTGTTTCTAAATTTAGCTAAATAATAACAATAGCAACTTTATAT
CAAAAAAAAAAAAAAAAAACTCG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (6)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)