Unigene SGN-U277730

Unigene Basic Information 
Unigene ID: SGN-U277730
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 277730
mRNA sequence: Length: 1729 bp

>SGN-U277730 Solanum tuberosum #4 (156 members)
CACTTTTGCTGTGATTCCCTTCTGTCTGCTGTGCCGCAATCTCCTAATTTCTCTTCTCTAAGTCTTTAAGTAACTCAAGATGGGTAAAGA
GAAGATTCACATCAGTATTGTGGTCATTGGTCATGTCGACTCTGGTAAGTCGACCACAACTGGTCACTTGATCTACAAGCTTGGTGGTAT
TGACAAGCGTGTTATTGAGAGGTTTGAGAAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAA
GGCTGAACGTGAGCGTGGTATCACTATTGATATTGCTTTGTGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGG
ACACAGGGACTTTATCAAGAACATGATCACTGGTACCTCCCAGGCCGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTTGA
AGCTGGTATCTCTAAAGATGGTCAGACCCGTGAACATGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAATGATTTGCTGCTGCAACAA
GATGGATGCTACCACCCCCAAGTACTCCAAGGCTAGGTACGATGAAATTGTGAAGGAAGTTTCTTCCTACCTCAAGAAGGTTGGTTACAA
CCCTGACAAAATCCCATTTGTCCCCATCTCTGGTTTTGAAGGAGATAATATGATTGAGAGGTCTACCAACCTCGACTGGTACAAGGGACC
AACCCTCCTTGATGCTCTCGACCAGATTAATGAGCCCAAGAGGCCAACAGACAAGCCACTCCGTCTCCCACTTCAGGATGTTTACAAGAT
TGGTGGTATTGGAACTGTCCCAGTTGGTCGTGTAGAGACTGGTGTGATCAAGCCTGGTATGGTTGTGACCTTTGGCCCTACTGGTTTGAC
AACTGAAGTCAAGTCTGTTGAGATGCACCACGAAGCTCTTCTGGAGGCACTCCCTGGTGACAATGTTGGGTTCAATGTTAAGAATGTTGC
TGTTAAGGATCTGAAGCGTGGTTTTGTTGCCTCAAACTCCAAGGATGACCCAGCTAAGGGGGCAGCCAGTTTCACTGCCCAGGTCATCAT
CATGAACCATCCAGGACAGATTGGAAATGGATATGCTCCAGTGCTGGACTGTCACACATCCCATATTGCTGTCAAGTTTGCTGAGATCTT
GACTAAGATTGACAGGCGTTCTGGTAAGGAACTCGAGAAGGAGCCTAAGTTCTTGAAGAACGGTGATGCTGGTATGGTTAAGATGATTCC
CACCAAGCCCATGGTTGTTGAGACCTTCTCCGAGTACCCACCATTGGGACGTTTTGCTGTGAGGGACATGCGTCAAACTGTTGCTGTTGG
TGTTATCAAGAGTGTTGACAAGAAGGACCCATCTGGAGCTAAGGTCACCAAGGCTGCTCAGAAGAAGAAATGAATGGTGCAGTTCAACTC
TGGAGTACCCAGAGATATCGATATCTACTATAATAAAGTGTGTTACGAAAACTTGCTATGCTTTACTCTTCCTGTTCATGTTCAGTTTTT
TATGTTGTTGTTGGGTTCTTGTTTTCTGCCTTGTATGTCAGGTATCCTTTCCCAGAACTGGGTGCTTGACAGACGGTGGCAAAATACATA
GTTCCAGTCGTTTGGTTTTTCTTTAGAGGTGTCTTGGTCCATCCAAGACGTCTCTAAAGATATGTTTATTTGTGTTTCTTATAATACGTA
AATCGTACTTTTCTGTCTT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
DQ284495 elongation factor-1 alpha
ef1a Elongation factor 1-alpha
Genomic locations (0)None
Library representation (19)  
mRNA member sequences (156)  
Alignment image suppressed for unigene with 156 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)