Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U279268

Unigene Basic Information 
Unigene ID: SGN-U279268
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 279268
mRNA sequence: Length: 1328 bp

>SGN-U279268 Solanum tuberosum #4 (3 members)
TTTAAACAAGAGAAAGGGAATGATTCTTCCTTTTGAGCCCTTTTCAATCACTTTTGACGATATCAGATATGCAGTAGATATGCCACAGGA
AATGAAAGCTCAAGGTTTTATCGAGGACCGACTTGAACTCTTGAAAGGGGTGAGTGGTGCTTTTAGGCCAGGAGTTTTGACAGCTCTAAT
GGGTGTTAGTGGAGCTGGTAAGACCACACTTATGGATGTCTTAGCTGGTAGGAAAACCGGTGGATACATAAGAAGGAACCATCAGTATAT
CAGGATACCCAAAGCAGCAAGAAACGTTTGCTCGGATAGCTGGATACTGTGAGCAAACTGACATTCATTCACCTCATGTTACGGTCTACG
AATCATTGCAGTATTCTGCTTGGCTTCGACTGCCTCGTGAAGTTGACACTGAAACCCGAAAGAGGTTCATAGAGGAGGTCATGGAACTAG
TAGAGCTAAAACCTCTAAGAGAAGCACTTGTTGGATTGCCTGGCGTGAATGGTCTTTCAACTGAACAACGAAAACGACTTACAGTTGCAG
TTGAACTAGTTGCCAATCCTTCTATAATATTCATGGATGAGCCAACCTCTGGATTAGATGCTAGAGCAGCTGCAATAGTGATGAGAACAG
TCAGAAACACTGTAGATACAGGTCGAACAGTAGTATGCACCATTCATCAACCTAGCATTGACATATTTGACGCTTTCGATGAGCTCCTAC
TCCTGAAACGAGGAGGCGAAGAAATATTTGTCGGCCCATTAGGACGCCATTCTTCTCACCTTATTATGTATTTTGAGGGAATCGATGGAG
TTCCGAAAATCAGAGATGGTTACAATCCAGCAACATGGATGTTGGACATAACTTCAGTAGCACAAGAAGCAGCCCTTGGAGTTGACTTTA
CTGAATTGTACAGGACCTCAGAATTGTATAGGAGAAACAAAGCTTTAATCCAGGGAACTAAGTGTGCCAGCCCCAGGTTCAAAAGACCTC
TACTTTCAAACTAAGTATTCTCAGTCTTTCTTCACCCAATCCATGGCTTGCTTCTGGAAACAGCACTGGTCGTACTGGCGAAATCCTCCT
TACACAGCAGTCAGGATCTTGTTTACATTCTTCATTGCTCTCATGTTTGGAACAATATTTTGGGATCTTGGCTCCAAAAGGAGAAGGCAA
CAAGATATTTTCGAATGCCATAGGTTCAATGTATGCTTCTGTCTTGTTTCTTGGGGTACAAAATGCTACTTCAGTGCAGCCAGTCGGTGC
TATTGAGGAGGACAGTTTTCTACAGGGAAAGAGCTGGTGGAATGTATTCAGCCTCTTGCCTTTATGCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
abc4 ATP-binding cassette transporter ABC4ATP-binding cassette transporter
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)