Unigene SGN-U281231

Unigene Basic Information 
Unigene ID: SGN-U281231
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 281231
mRNA sequence: Length: 922 bp

>SGN-U281231 Solanum tuberosum #4 (228 members)
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGGGCAGAGAGAGAGAG
AGATTGAGAGCAAAAAAAAGAGAAAAAGTAGAAGAAGCAATATGGCTTCCTCTGTTATTTCCTCTGCAGCTGTTGCTACACGCACCAATG
TTACACAAGCAAGCAGCATGGTTGCACCTTTCACTGGTCTCAAATCTACTGCTACTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATCA
CTTCCATTGCTAGCAATGGTGGAAGAGTTAGGTGCATGCAGGTATGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTC
CTGATTTGACTGACGAGCAATTGCTTAAGGAAGTTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTTGAGACTGAGCACG
GATTTGTCTACCGTGAGAACAACAAGTCACCAGGATACTATGATGGAAGGTACTGGACCATGTGGAAGTTGCCCATGTTTGGGTGCACTG
ATGCAACCCAAGTGTTGGCTGAGGTTCAAGAGTGTAAGAACGCATACCCACAAGCATGGATCAGAATCATTGGATTCGACAATGTGCGTC
AAGTGCAGTGTATCAGTTTCATTGCCTACAAGCCAGAAGGCTACTAAGTTTCATATTAGGAACAAAATTGTCTTTAGGGACACTTTGTTT
TTAAATGCTACTTAGGTTTCTTTTTTGTTTTTTTCTTAATTCCAACAAACTGTTTATGTTTTCTTAATAATTTACTATTCGGTTTATGCT
TTGGATTTATGAGGACCTAATTATATGATGATTTGGTGCTTTGTTTGTAAAAAAAAAAAAAATAAGATTCTTGTGGTTTATATGACTTTT
GTGTTTTATAATAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
rbcS1 ribulose-(1,5)-bisphosphate carboxylase/oxygenase S1
rbcs3 ribulose-(1,5)-bisphosphate carboxylase/oxygenase small subunitphotosynthesis
Genomic locations (0)None
Library representation (10)  
mRNA member sequences (228)  
Alignment image suppressed for unigene with 228 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)