Unigene SGN-U281234

Unigene Basic Information 
Unigene ID: SGN-U281234
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 281234
mRNA sequence: Length: 1987 bp

>SGN-U281234 Solanum tuberosum #4 (130 members)
CTTTCTCTTCAGGGTTTCTCTAGTAGTCTCTCTGAAAAAAAATGGCCGACGTTGAATACAGGTGCTTCGTCGGTGGTCTGGCATGGGCCA
CCACCGACCAAACACTTTCGGATGCTTTTTCTCAGTACGGCGAAGTGGTCGAATCCAAGGTCTGTTGCAGGGCAGAGATCGGATCCGAGC
CTTTGGCTTCGATGACCCTCTGTTACTGAATTGTGATCTGTTACTATTCTCTGGTTTACTTGACTGTTACTGTTACTGTTACTCTATGTT
ACTGTTACTATTTGTTACTATTATTCCAATTCCCCGAAACGGTACGTTCCGTCTTCCTCTGTTTATACACGAGATGAAGATAGATCGCTT
TTGTGTTTCTCCCCCTCATGTTTTTTTGTTCAGATCTGCTTTGTTTTGGTTGTTATTTTGTAGATCTGTTTGGATCTGACGTAATTGTTA
TGGTTTTTATTTCTATTTTTCAGATCATCAATGACCGGGAAACTGGTAGATCTAGAGGATTTGGATTCGTTACCTTCAAGGATGAGCAAG
CCATGAGGGATGCTATTGAAGGGATGAACGGCCAAGATCTTGATGGTCGCAACATCACCGTGAACGAAGCTCAATCCCGCGGAGGCGGTG
GAGGTGGAAGAGGCGGTGGTGGCTACGGAGGTGGCCGACGTGAAGGCGGTGGTGGCGGCTACGGTGGCGGCGGCGGCTACGGAGGTGGCA
GACGTGAAGGTGGTGGCGGCGGCGGCTACAGTGGAGGTGGTGGCGGCTACGGAGGTGGTCGTCGTGAAGGTGGTTACGGTGGAGGCGGTG
GTGGTTATGGTGGAGGTGACCGCTACAGTGATCGCTCTTCAAGAGGTGGTGGAGGTGGTTCTTCCGATGGAAACTGGAGGAGTTAGATTT
GTTGTTCGCTTTTAGATTGTTTTTGTTTGAACTTATTTATGGTTTCGAAGTTTGGTTGATGTCCCGTTTATGATTTACCGTGGTTACTGT
TACTGTTCTCTTTTTTGACCGCTATTGGTGTTACCTTGTGGATCTCTGTTTACAAAGTTCTCATGAATGGAAGTGAATGAAGATTTACTA
TTTAAAGTCCAAAAAAAAAAACAATAAACTTATTATTATTATTATTTCAAAATACATAGCAAAACAACATTATAGTTTTTTTTTAAATTA
TTATAGTACTACTAATCTACTACTAATGGATATAATAGTAGTAGCAGTAGCTAGAAAGCCACTGAATATACTCAAGTTAGCTTTCATCAA
AACCTAATTACACATATATTAGTACTAGTTAATTAATACTTATAATAAGGCATTGACAGAAAACATAGGATTAACATCCACTAATTAATC
TCCATGTTTCTGTAGCATAGCAACTTGTACATTAAAAGGAAAATACGTTATTTACATGTAACATTATTCAGATACCGCTCTGTCACGATC
CAAAATCTTTTATTCTTTCATTTCACTGATGCTTGGATCGGGTATCCCCACTGTAGAGCCAATCATAAACAGTGGGAGCATTGGGGTGAG
ATGGTTTGTCAAAGACTTCAGCACCAATTCTCTTGGTGGCAATGTTGCTCCCCGGATTGAACACGCTCCTCCACACATTATCTTTACGCG
CCGATGGCGAGTAAGTGTTTGGGGTCACTGGGGTTCCCGGTGTCCCCGGGCTCGATAAGCCTGAGCCTGAGCCCGGCATAGACAAAGACC
TTTGGTAGCTCTTGCTTGCTCCTTCTCCTCCTTCCCCGCCATGAGCTTGGATTAGAGTTATGGACTTTCTAAGTTTGCCAAGGCCTTTAT
CAGGTTGAGGTCCAGCCATAACATCATCCCAAAGCTTTTCAATTAACACCATCTTTTTCTTTTTTCTCTTTTCTCTCTCTCTCTCTCTCT
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
CTCTCTC


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
DQ241855 glycine-rich RNA binding proteinglycine-rich RNA binding protein
DQ207875 DQ207875 glycine-rich RNA binding proteinRNA binding
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (130)  
Alignment image suppressed for unigene with 130 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (3)