Unigene SGN-U281332

Unigene Basic Information 
Unigene ID: SGN-U281332
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 281332
mRNA sequence: Length: 1528 bp

>SGN-U281332 Solanum tuberosum #4 (107 members)
TTTTAGAAGGAAACATACATTATCATATATCTCAACCAAGCTAAACTCAACAACCCATTAATAGTGATGCATAGTGTTGCAATAATACAA
TATACTGAAAGAAATAGAAAAAACAAACAGTATATCTGTTTGCTAAAGAGAATGTTACTTTACGATCGCGTGTTTAAGAGAGAGAAGAAT
TTCATTGATCAATTTGTCTATATTCACATAAGATGATCCTGCTGGTTTTGCAGCAGCTTCTTCAGCTAATATCTTCCATTCCATTGCCTT
TTTCTTCATCTCTTTGCCTTTCTCCCCGGTCATCAGCTCTCTTACAAGGGCTTCAACTTCATCCCTCTTCACATTATTGTTAATCTCCAT
TCCAATCCCCAACTTGGTACAACAAAACCAACAGTTAGTTGGCTGCTCTGCGAAAAACGGCCAGCAAATCATTGGCACCCCATTGCTAAT
ACTTTCTAGGGTCGAGTTCCATCCACTGTGAGTCAAGAACCCTCCAATTGCGGGGTGGTTAAAGGACTTTTTCTTGTTGGCACCAGCAAT
CTTTCAATTTCATACCATCAAACACTCACTTTTTTCTCTTATATAAACCATGGCAGCTGCTACAATGGCTCTTTCTTCCCCTTCTTTTGC
TGGACAGGCAGTGAAACTCTCACCATCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGCCAAGTCTGCCCC
ATCTAGCAGCCCATGGTATGGCCCTGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAGCTACTTGACCGGTGAATTCCC
TGGTGACTATGGGTGGGATACCGCTGGACTTTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCAGATG
GGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTCTTGGCCCGTAATGGTGTCAAGTTCGGTGAGGCTGTGTGGTTCAAGGCCGG
ATCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCATCTTGGCCATCTGGGCTTGCCA
AGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCTGGTGGCAGCTT
TGACCCATTAGGCCTTGCTGAAGACCCAGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCTAT
GTTTGGATTCTTCGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAACGC
TTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAATATAATTTTTGAATTTTGATTGTTCGATGGCCCTGTAAAGTAGT
TGTGACTTACTTGATAATAGAATGGTTCTTTTTTCCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
lhcb1 chlorophyll a/b binding protein chlorophyll binding
ftrbpot Ferredoxin-thioredoxin-reductase catalytic subunit BFerredoxin-thioredoxin-reductase
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (107)  
Alignment image suppressed for unigene with 107 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)