Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U281348

Unigene Basic Information 
Unigene ID: SGN-U281348
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 281348
mRNA sequence: Length: 826 bp

>SGN-U281348 Solanum tuberosum #4 (15 members)
GTGCTAACCTCAAAGTGAAGTCAAAGAATCATTATGAAGTTGTGCTCTCTGCTAAACCATTTGCTTATGCTCCAAAAACTCCATATGAAG
AATGCATGAAGCCTAAGCCAACCCCAACTCCTTACTACTACAAATCTCCTCCACCACCATCACCAAAATACGTGTACAAGTCCCCACCTC
CTCCATCCCCCAAGTACGTGTACAAGTCACCACCACCATACTACTACTCCTCGCCACCACCACCCAAGAAGTCACCTCCTCCACCATACT
ACTACAGTTCTCCACCACCACCAGTTAAGTCACCTCCACCCCCACTTCCATACCCCCAATGTGGAATGAAAAAGGGTGGTGGGAAATGTA
TTAAAACAGGAGAGTGTTGTAGTATATGGGGTTGGTGTGGAACCACAACCGAGTATTGTTCTCCTGGATATTGTCAGATGCAATGTCCAG
ATCCATACCCAGAGGGACGATGCGGATGGCAAGCTAATGGTAAATCATGTCCTACTGGTACTGGACAGTGTTGTAGTAACGCTGGTTGGT
GTGGGACCACATCAGATTATTGCGCTCCTGTAAACTGTCAAGCCCAATGCAACACTACTACTCTAACCTCACCCATCAAGAATCGTATGA
GAGGTATTGAGAGTTTCATGCTCAACGTTGTCTAGATGCTACTTCCAAAATACTATCTACAGGATGTACTTTTACTCCTCTTTTGGAACT
GCATGCTGAAATAATTCCAATATTAATGCGTGTAATTAATGCATATAAAATGCATTAAGTAATAATATAATAGTAAATAAAGATCTTTTG
TCTAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
met32 X79053 ATP sulphurylaseATP sulphurylase
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (15)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)