Unigene SGN-U281366

Unigene Basic Information 
Unigene ID: SGN-U281366
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 281366
mRNA sequence: Length: 796 bp

>SGN-U281366 Solanum tuberosum #4 (164 members)
ATTGTCAACAATGGCTTCCTCTATAGTTTCTTCAGCTGCTGTTGCCACTCGCGCCAATGGTGCACAAGCCAGCATGGTTGCCCCCTTCAC
TGGACTCAAGTCCGCCGCCTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAATGGTGGAAGAGTCAGATG
CATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTATCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAAGGAAGT
TGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACAACAAGTCACCAGG
ATACTACGATGGCAGATACTGGACCATGTGGAAGTTGCCCATGTTTGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGGAGGAGGC
AAAGAAGGCTTACCCACAGGCATGGATCCGTATCATCGGATTCGACAACGTTCGTCAAGTGCAGTGCATCAGTTTCATTGCTTACAAGCC
CGAAGGATACTAAAATGCCAAGTTTTAATTAATGTAATGTATAACTGACCCTATGTATTTAGGGGAAGCTTGTTTGAATCCTCCTTAAGT
TTTTCCCTGGAGAAACTGTATTAATTTTACGTTGTTGTTTCCCTTCATCTTTCGAATTAATGGCATTTGTTTTAATACTAATCTGCTCTG
AAACTTGTAATCAGTTATAATTTATCCAAGTAATATCTTCCATTCTCAAAAAAAAAAAAAAAAAAAAAAAACTCAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
bcS2 ribulose-(1,5)-bisphosphate carboxylase/oxygenase S2ribulose-(1,5)-bisphosphate carboxylase/oxygenase
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (164)  
Alignment image suppressed for unigene with 164 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)