Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U281378

Unigene Basic Information 
Unigene ID: SGN-U281378
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 281378
mRNA sequence: Length: 2184 bp

>SGN-U281378 Solanum tuberosum #4 (120 members)
GGGAGCAACGAGCAGGAGGGGTACACTCCCCCNTTACATAGGCCATTTCTGCAAACATGTTTGGCTCATTGATTGTGGTCCAACACTTCA
CTTCTATCACCAAAACTCGCAAAACAAATCTGAGCAAAATACAAAAATTCTTCCCTAGTATTTACACAAATAAACATACTGCATGACAGG
ATTAAGCCATCCCCCATATTTTTCCTCGAGTTCATGTGGATGGTCGTGGTGATTAAGAGTCACAAAAGGTGTTATTCCTTTGAGTAAGAG
AGAATCAATGAGTTTGTTGTAGAACGTAACACCAGCAAGATTTACTTTACCAAACCTTCCTCTAGGAAGGACTCTGCTCCACGAGATAGA
GAAACGATACGAATTCAAGCCAATAGAGTGCATTAACTCAACATCTTCCTGAAATCTATGGTAATGATCATCCGCTATATCTCCAGTATC
TCCATTATTTATCCTTCCTTACCACTACCTCGTGGAGGTAGAGAGGCTGTTTCCGGAGACCCTCAGCTCAAGAACATCAAATCTTTAGTA
TGACTAAAAACATCCCAATTACTCAACCCTTTTCCATCTTCAAGAAATCCCCCTTCAATTTGATAAGCTGAAGTAGTAGTTCCAAATAAA
AACCCATCTGGAAATTCTGATTTCTTCAATTTTTTCTGTTCCTCAAATGAATTTACAAATACAAAGAGTAGTAAACACAGAAAAAAATAA
GCAACTGAAATAATTAGTACTGCTAATCTTCATCTGGGGTTTAAAAAATTAACCCAAAATTTGATGGAGTTTCATCCGGAATCTAGCTCT
CAGTTAGCTATGGGTGAAGCCTTTGGTGCTTTTCAACCAACTCAAAAGCTTGATGTGGACATAGCAACTCATATCCATGTCTATGATGAT
GGTCCTGAACGAAGCTTACTGTGTGTAGAGGCAGCAGATCGACCTGGATTAATAGTTGATCTCGTCAAGATCATTACTGAAATAAACATT
GATGTTATATCAGGAGAATTTGACACCGAGGGACTGCTAGCTAAGGCAAAATTTCATGTAAGCTACAAGAACAAAGCTCTCATCAAGCCC
CTTCAACAGGTTCTTGCAAACAGCTTGCGCTATTACTTGAGGAGACCAACAACAGAAGAGTCGAGCTTCTAATACATTGCAGCATGAGAG
ATGAGACAATCAGTTGGTTTAACCATGCACTTTTTAACTGTCACAACAAAACGCGTGTTGAAACATGCATGAAAAAATCTAGAAAAAAAA
TATAATTTCATTACTGCTCTAACATTGTAAAATGCTACCATCTATACGATCATCGTCTTTGAATAAACATTTCCAAAGTGGTAAGAGCCA
TTTATATACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTGTTCAAGGGAAGCAAAGATAAGCACTCAGAAATG
GCTTCTTCAGTGATGTCCTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCCAGCATGGTTGCACCCTTCACTGGCCTCAAGTCC
GCCGCCTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAATGGTGGAAGAGTCAGATGCATGCAGGTGTGG
CCACCAATTAACATGAAGAAGTACGAGACTCTCTCATACCTTCCTGATTTATCTGACGAGCAATTGCTCAAGGAAGTTGAGTACCTATTG
AAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACAACAAGTCACCAGGATACTACGATGGC
AGATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGTACTGATGCAACCCAGGTCTTGGCTGAGGTGGAGGAGGCAAAGAAGGCTTAC
CCACAGGCATGGATCCGTATCATCGGATTCGACAACGTTCGTCAAGTGCAGTGTATCAGTTTCATTGCTTACAAGCCCGAAGGATACTAA
GTTCTAAAGATAACTAATTGCCCTATTTCTATAGGGACAGTTTGTTTGAATTCTCCTTTGGTTTTTCCCGGGAGAAACTGTATTCATTTT
CCCTTGTTTTCCTTCTTCTTTCTATTCAGTGTATGATCAATTCGAATTTCAATCAAGTTTACAAGAACTATTAATGACATTTGTTTCTTT
ACTAAAAAAAAAAAAAAAAAAAAC


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
bcS2 ribulose-(1,5)-bisphosphate carboxylase/oxygenase S2ribulose-(1,5)-bisphosphate carboxylase/oxygenase
poac75 PoAc75 gene for actinactin
ugpase UDP-glucose pyrophosphorylase (UGPase) geneUDP-glucose pyrophosphorylase
Genomic locations (0)None
Library representation (11)  
mRNA member sequences (120)  
Alignment image suppressed for unigene with 120 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (2)