Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U286880

Unigene Basic Information 
Unigene ID: SGN-U286880
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 286880
mRNA sequence: Length: 198 bp

>SGN-U286880 Solanum tuberosum #4 (1 members)
CCTCGTGCCGCAGAGGTAGAAGAACAGCAGACGCAATGGGTGCTTACACTTATGTGTCGGAGCTATGGAGGAAGAAGCAGTCAGATGTTA
TGAGGTTCTTGCAAAGGGTGAGGTGCTGGGAGTACCGTCAACTCCCTTCTATCGTCCGTGATCAACCAGTGCCTACCCGTCCTGACAGAG
GTCACGCCGCGTTGGGAT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ284461 60S ribosomal protein L15
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E568792
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)