Unigene SGN-U286898

Unigene Basic Information 
Unigene ID: SGN-U286898
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 286898
mRNA sequence: Length: 535 bp

>SGN-U286898 Solanum tuberosum #4 (1 members)
ATTTATTTTCCTCTTTCCCATTTTCTTATTTTTCAACTTTATTCCAATGGCCAGTGTTGAGGTTGAATCTGCACCAGTAGCAGCAGTAGA
GACTACTCCAGCTGAGGTTGAGGCTACCCCAGCTCCAGAGGTAACCAAGGGTAGCATTTAATTATTTGATCGTCTTATCTAAAAGCTTAA
TCTGTTAAAAGAAGTTACACTTTTAATTACTTAATAATGTTTTGTAACACCTGGCTCACATGTTATGTTGCTTGGAATCTTCAAAACTGT
GATTGCATGCGTTCCTGTCAGATCCTTAGAAAGTAATATAGTTTTTGAGGATCTGACACGGATGCGGTATCAAACATAGCTCAAGTGTTG
GTCTGATTATTTTGTTTTGCTTGTCCAAACACGTGGAAGTTCTTTTTTATAATAGTAGTGGTGCGATTTGAACTCAGGACATCTGACTGG
TCTGATATCGTATTGAATTTTGCATGATCATGTTATTTAAAGTAGGTTTTAATTAACTTAATTGTGTCTTCAACAGGTGGAGGAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Z11679 Z11679 induced stolon tip protein
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E569652
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (3)  
Gene Family (6)  
Preceding Unigenes (1)