Unigene SGN-U286965

Unigene Basic Information 
Unigene ID: SGN-U286965
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 286965
mRNA sequence: Length: 605 bp

>SGN-U286965 Solanum tuberosum #4 (1 members)
TGTTTGTGAAACAAATGGGTCTTTCTGATAAGGATATTGTTGCACTCTCTGGTGCCCATACCTTGGTTTGTTGCCTGCTTTTACTGTTTA
ATCCTATATGTTGCGAGGTTCTATTCCTACATGCTTATTTCTTATGATATTTTTCTCCAGGGAAGGTGCCACAAGGAGCGTTCTGGTTTT
GAGGGACCTTGGACCGCCAATCCCCTTATCTTTGACAACTCATACTTTACGTAAGAATCTAAAACAGTCTTTTTTGAGTTCTCCTTTTGT
GGAATACTTGACTGTTATCAGTCCATTTTGTTTACTAGACATTTGTTATTGTCAGGGAGCTTTTGAGTGGGGAAAAAGAAGGGCTCTTAC
AGTTGCCATCAGACAAGGCTCTCCTCTGCGATCCTGCTTTCCGCCCCTTGTTGAGAAATATGCTGCGGTTAGTATATATATTAATTGTAT
AATACTATTCATCTAAGTTGGTATAATGCTGGCTGTGTTGACTGATTGGAACAACTCTTGGCTTATGTCAGGATGAAGATGCCTTCTTCG
CTGACTATGCTAAGGGTCACTTGACACTCTCTGGAATTGGGGTAGGCAGGCATACATAATATCTT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
apx ascorbate peroxidaseascorbate peroxidase
AY742959 cytosolic ascorbate peroxidasecytosolic ascorbate peroxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E560218
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (4)  
Preceding Unigenes (1)