Notice: SGN will be briefly unavailable for maintenance. Apologies.

Unigene SGN-U287138

Unigene Basic Information 
Unigene ID: SGN-U287138
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287138
mRNA sequence: Length: 716 bp

>SGN-U287138 Solanum tuberosum #4 (1 members)
AAAACACAAGGCACTTCCATTAAAGTGTTTCATGAAATTCTAAATTCTCATCAAAATTCTAAACAGGAAACTAATTTAGATGATTCCAAT
TTTGTTGGCCACATCCAAAGCATCATAGTCTGGAGTCAACCTCACATATGCCTTCTTAGTCCCATCAGGCCTGATCAAGGTATTGATTTT
TTTTTTTTTTTTTTTTTTAAGGTCAGGATAGGAACATTTACCCAGAAAGTGAGACTACAATTTATTTGCCAACTTTTGGGCAATCTATTT
CAAACTGACCCAGAACATGCTTAGACGACGATTCTTCGTCTGACAGAAATCATGGGGTCAAGTCAATTCCAGGCTAGTATCAGCTAATTT
TGGCTCTCATTTGGCCATGTCCTTGAATAATTCAACGAGGCAGGATCAGAGTGAGCTTCATACTCACCATTGCTTCTTCCCCTTTTTCTT
TCTCTTGTTTCCACTTCCACTACCGTTGCCTGTACTACTAGTACTCTTGGAGGTACTTCCAGCTGGTGTAGATGGGCTCTGTGGCGCGCT
GCCATCAAAATCATCAAACATACCAGCTTGTACAGCATTCTGTAGCCACTCGACAAATTCTTCCTCGGTCATGCTCTCTTCCATATTTGG
GCATTGGCATCCCACCTTTTTTGTCCTTGAGCTACTTTCTCTTCCCATTGCTGTTCTTTCAAAGCTTACACTAGTATTTACATGGA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ200381 ribosomal protein L25
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E600187
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None