Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U287180

Unigene Basic Information 
Unigene ID: SGN-U287180
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287180
mRNA sequence: Length: 666 bp

>SGN-U287180 Solanum tuberosum #4 (1 members)
ATATATTTTTTTATGACAAGGGAAACCCGCAGCCGCTACCCTTTGGGTGCGTACAGGGTAAAACCCCCGTTCCTATGCAATAGCTCGCAA
ACCACATAGGAGAGGTAACCCGCACTAGGCAAGCCTGGTGCGACGAGCTCGACCCAGAAGGCAAGCCCCTTGCTTTCGCTGGCAAGGGAT
TTCGAACTTGAGACCTCCAACATGGAAGTCCCAAGCTCAAACCACTGGGCCACCCTGAAGGGTCCATCTTAGTTCAATATTAATAGAACA
TCTTCATATACACCCCCGAAAAATAATATACATCAACCCCACATACGCTGTAAAAGCTCTCAAATCATAGAGATATTTTGTACGCAAGAT
AAAACAACTTAACTCTATGATCTTTAGCAGACCCATAATGTCACAGAACACTTGCTGCTAAAGAAGACAACAAAGAATCTAGATAGAGTG
GCATTGTCATACACTACTACATACAGAGTTCAATATCCTAGCAAGTGCAACAACTTTCAAACAACTTAGATCAGAAATAGAACAAGACAT
TGCNCAATAGAAGTGAAAGAAACGAATTCAATGGACCCTCTTTTTATAGTTAGAATGAATGCAATGAAACTTACAATGCCACAGCCTGTT
TAACTCATGAAAAGAGCTTCAATTTTGCTTTGTATC


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
acs1a (STAC1) gene for amino cyclopropane carboxylate acid synthaseACC synthase
AY753547 phytoalexin-deficient 4-2
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E427658
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)