Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U287181

Unigene Basic Information 
Unigene ID: SGN-U287181
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287181
mRNA sequence: Length: 629 bp

>SGN-U287181 Solanum tuberosum #4 (1 members)
CAAATTGCACCTTCAATTATTATTTTTATTTTCCTAAAACTATGATTTTGTTGTTGTTTTTTTCTTTAATCCTTCGTAACTATGATTTAT
TAGAGTAAAATTATGAGTTTATACCTGTTATTTATTGCAAATTTGATGAAATTTTGCACATGAATTCTTGTTGAAATTACTGAATCAGTA
TTAGCACTGTGATAGAGTGATCCGAGTTGACATGATTTTGTTTTGTTTTGTTTTGTTCCAATGGGGATTTTTTAATTTCATAACTTTTAG
GAACATTCTGCTTGAAGGGATCAACTCTGTGATAACATTTCTGAATTATAACTAGTTAGAGTCAATGTAATCAAAGACGAAGGTCTGTTG
GGGATTTTAAGCGCACAATGCAAATATAAATGCAAATATGTATGTGTATTTCAAGACTAATAATTATACGCATGAATAACAAAGATATGA
GTAAGGAAACACCCTTCGGGATGGCCCAGTGGTTCGGGCTTGGGACTTCCATGTTGGAGGTCTCAAGTTCGAAGCCCCTTGCCAGCGAAA
GCAAGGGGTTTGCCTTCTGGGTCGAGCTCGTCGTGTCAAGCTTGCCTAGTGCGGGTTACCTCTCCTATGTGGTTTGCGAGCTATTGCAT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
acs1a (STAC1) gene for amino cyclopropane carboxylate acid synthaseACC synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E446525
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)