Unigene SGN-U287276

Unigene Basic Information 
Unigene ID: SGN-U287276
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287276
mRNA sequence: Length: 760 bp

>SGN-U287276 Solanum tuberosum #4 (1 members)
GGTGAACCATGGAATTCCACATGAAGTAATGGACACAGTAGATAAAATGACAAAGGGACATTACAAGAAGTGCATGGAACAGAGGTTCAA
AGAATTGGTAGCAAGCAAAGGTCTTGAAGCTGTTCAAGCTGAGGTTACTGATTTAGATTGGGAAAGCACATTCTTCTTGCGCCATCTTCC
TACTTCTAATATCTCTCAAGTACCCGATCTTGATGGCGAATACAGAGAGGTAATGAGAGATTTTGCTAAAAGATTGGAGAAATTGGCAGA
GGAGTTACTTGACTTGCTATGTGAAAATCTTGGACTTGAAAAAGGTTACTTGAAAAATGCCTTTTATGGATCAAAAGGTCCCAATTTTGG
GACTAAAGTTAGCAACTATCCACCATGTCCTAAGCCTGATTTGATAAAGGGACTCCGCGCTCATACAGACGCTGGTGGCATCATACTTCT
ATTCCAAGATGACAAAGTGAGTGGCCTTCAACTCCTCAAAGACGAGCAATGGATCGATGTTCCTCCCATGCGCCACTCTATTGTGGTTAA
CCTTGGTGACCAACTTGAGGTACAAGATTCACTAAGTGTGTGTGCTTTTCTCACTATAACTTAGAAGTTGTACTANNAATGGTATTTATG
AAATGTGAAAACAGGTGATCACCAACGGGAAGTACAAGAGTGTGATGCACAGAGTGATTGCACAAACAGACGGGACACGAATGTCACTAG
CCTCATTTTACAATCCAGGGAAGTGATGCAGTAATATATC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
aco1 1-aminocyclopropane-1-carboxylate oxidase 1aco1
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E401123
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)