Unigene SGN-U287507

Unigene Basic Information 
Unigene ID: SGN-U287507
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287507
mRNA sequence: Length: 1207 bp

>SGN-U287507 Solanum tuberosum #4 (1 members)
GAAACAAAGAAGAGAAGTTGTTTCAAATATGGGGAAAATGGCCTCTCTAGTTGCCACTCTTTTAGTTGTTTTAGTGTCACTTAGTTTAGC
TTCTGAAAGCTCCGCAAATTATCAATACTCATCTCCTCCACCACCAGTGCATGTCTATCCATCACCACCCCACCATCCAGTGTATAAGTC
TCCTCCACCACACCATCATCATCCCGTTTACAAGTCTCCACCACCATCTGAGAAGCCACACTACCCTCCACACACCCCAGTTTACAAGTC
TCCTCCACCACACCATCACCATCCCGTTTACAAGTCTCCACCACCTCCAACTCCTGTTTACAAGTCGCCACCACCACCTAAGACGCCACA
CTACCCTCCACACACCCCAGTTTATAAGTCTCCTCCTCCACACCATCATCATCCCGTTTACAAGTTTCCACCACCTCCAACTCCTGTTTA
CAAGTCGCCACCACCACCCAAGGACCCACACTACCCTCCACACACCCCGGTTTACAAGTCACCACCACCACCAACTCCGGTTTACAAGTC
TCCACCACCACCAACTCCCGTTTACAAGTCCCCACCACCACCAACTCCCGTTTACAAGTCCCCACCACCACCAGTGAAGCCATACCATCC
TGCACCAGTATACAAGTCTCCACCACCCCCAACTCCCGTTTACAAATCACCACCAGTGAAGCCATACCATCCTGCACCCGTATACAAGTC
TCCACCCCCACCAACTCCCATTTACAAGTCCCCACCACCACCAGTAAAGCCATACCATCCTTCTCCAACACCATACCATCCTAAACCAGT
ATACAAGTCTCCACCACCACCAACTCCAGTCTACAAGTCTCCACCACCAACCCACTATGTTTACTCCTCTCCCCCTCCTCCCTACCATTA
CTAAGAAGTGACTTCATTATATCTGAGGAAAAGCAGAATGTTTGAGCTGAAAGAAAGGCATTTTCCATTTTCAAGAGACAATGAAAAAAG
AAGAAAATTATAGTTATAGTAGTAAATAATAAGGCTTACAGAAGACGAAGTTCTTTTGTAGCTTCATGTTATCTAAGTTAATGTCTTAGT
GATATTGTTTTGTACTCTATTTTTATATTTTACTTTTATGTCTTTTTGTATGTTTGCTCAGATTCAATCTCCTTGCAAAATGCAGAGATT
AATTATGAGATAAATAAAATAAGTTATTACTACTCCT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Z21937 Z21937 extensin
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E624683
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None