Unigene SGN-U287593

Unigene Basic Information 
Unigene ID: SGN-U287593
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287593
mRNA sequence: Length: 736 bp

>SGN-U287593 Solanum tuberosum #4 (1 members)
CAGGAACGTATGATGCTAAATCAAAGACTGGTGGACCAAATGGTTCTATCAGAAATGAGGAAGAGTTCACTCATGGTGCTAATAATGGCT
TGAAAATCGCTCTTGATTTTTGCGAAGCAGTGAAGGCTAAACATCCAAAGATTACGTATGCAGATCTATACCAGCTTGCAGGTGTTGTTG
CAGTCGAGGTGACTGGTGGTCCGACTATTGAATTTGTCCCTGGTAGGAAGGATTCCAGTGTTTCTCCAAAGGAAGGGCGGTTACCAGATG
CTAAACAAGGATGGGTTTGTCTGACAAAGATATAGTGGCTCTATCAGGGGGTCATACACTGGGAAGGGCACATCCAGAGAGATCAGGCTT
TGATGGTCCATGGACAAAGGAGCCACTGAAATTTGACAATTCATATTTTGTGGAGCTGCTTAAGGGGGAAAGCGAGGGATTACTGAAACT
TCCCACAGACATTGCTTTATTGGATGATCCTGAGTTCAGACATTATGTTGAGCTGTATGCTAAGGATGAAGATGCCTTCTTTAGGGATTA
CGCCATATCACACAAGAAACTATCTGAGCTANGGTTTACCCCAAGTTCTGGTTCCAAGGCTATGGGTGAGGGATGGCACAATTTTAGCAC
AGAGTGCTGTAAGGTGTTGTTGTGGCTGCTGCAGTGGTGGCACTGAGTTATTGGTATGAAGTGCNGAAAAGGATGAAGTAATTGCAGCAC
GACTGATTGCATTCTT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
AY742957 peroxisomal ascorbate peroxidaseperoxisomal ascorbate peroxidase
AY742959 cytosolic ascorbate peroxidasecytosolic ascorbate peroxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E410266
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)