Unigene SGN-U287819

Unigene Basic Information 
Unigene ID: SGN-U287819
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 287819
mRNA sequence: Length: 706 bp

>SGN-U287819 Solanum tuberosum #4 (1 members)
GCCATTGTCCCCAACCACATTCCGGGAGGAATTATATTGGGTTGAGGAAGAACATCAGATCTTTAAGACACTTCAGAGGAGAGAAGGCTT
AGAGAAGCGGCTATGCGTGCTAAGGTTGAAAAAACAGCACTTCTGAAAACTGAAACAAAGGAAAGAACTATGAAATCATTTTTACTGTCT
CAGAAGCATGTAGTATATACTGAGCCTCTTGATATCCAAGCTGGAAGCAGCGTCACAGTTTACTATAATCCCGCCAATACAGTACTTAAT
GGTAAACCTGAAATTTGGTTCAGATGTTCATTTAATCGCTGGACTCACCGCCTGGGTCCATTGCCACCTCAGAAAATGTCGCCTGCTGAA
AATGGCACCCATGTCAGAGCAACTGGTTAGTTTTCACGCACTCTGATGTCAGTTTACAAACACTACAGACTGTCCGTCATCATAGCTTCA
ACTAGAAATAATTTTCACGCACGCTTAGTATATCTTTAATATTAAAAAGAAATATAATTTGAGTTGCAGTTTCTTGGCACATATATTTCT
CTATTTTTTCTAGACAAAATGTGGTGGTAACCGATAGCTAGAAGTGGTAATTGGTGAAGCTGAGGATGAACCATCTTGGATATGGGAATC
CGAGAACGTTAGGATTCTAAGGAAGTAAGAAAGTAACTTAAGTCTCTAATGCATTTATGTGGAATAAGTTTGAACC


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
sss3 soluble starch synthase 3soluble starch synthase
X95759 X95759 starch synthasestarch synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E558067
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)