Unigene SGN-U288131

Unigene Basic Information 
Unigene ID: SGN-U288131
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 288131
mRNA sequence: Length: 776 bp

>SGN-U288131 Solanum tuberosum #4 (1 members)
ACATAAAATTGTTTATGTATCATTTGGCTGGGAGAGCATAATAATGTCATACAGATGTATTCAACTCCACTACGAGTAAATTGATATTAT
CCCTACTACCTCGATCAATTGCTAAACACATCATTCACTCCAATCATTATGACATCCGGTCCAATCATGCAATTACATCATCGAAACTAT
CTAATACGATTGCGAGACACTAACGTTTGCCACTATAACAATTATCACCGGATGGTCTTGCGTCCATGGAGGAAAATGGTTCACTAGCCC
CATCTTGGCTCTGTATGGCATCGGTGTAGACCTCAAGTTCTTTTAAAATGCCATAAGCATCAAATGTGTCATCTACTATCAAAATCATTG
CTATAGTCTTAGCAAACATGACACGAGCCTGAGAGTACTGAGGTTCAGCATACACTCCCACTGTCCAAAAGTAGCATTCGGCTGCTCTAT
CCCTAGCATATGGAAGTGTTGTCACAAAATCCAAATCTTTCCACCACCTTGATACTTCACTGAGTTCTTGCTTGTGCAACATCTGGAGTA
AGTTGAAATCCAGTTTTGCAAATCGGAGCAACACATCATTCTTAAATTCCTCCTCTTCGTAGATGGAGATGAAGTAGCGTGTCTCGACTC
TTGGAATGCTCTTATGAAGAGATTTCGCAAGTGCATGTGTCACTTGTTTACTCAGTGGTGACTTCAAACTGTGGAGCTGCAGACTCAAGA
TGAGGCAGTAAGAGAAAAGCACAGTGCTTCTTCTAAAATATCTTCTCCATGAGTCC


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
pvs1 vetispiradiene synthase 1vetispiradiene synthase
pvs3 vetispiradiene synthase 3vetispiradiene synthase
pvs2 vetispiradiene synthase 2vetispiradiene synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E619281
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None