Unigene SGN-U288409

Unigene Basic Information 
Unigene ID: SGN-U288409
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 288409
mRNA sequence: Length: 584 bp

>SGN-U288409 Solanum tuberosum #4 (1 members)
CCTTCAACTAGCTCCATTGATTTCACTAGGCCTTAAATTTGTACCAAACTTTCTTGAAGATTTCGTCTTGCACACTTACCCTCTACCTTA
CTTTCTTGTAAAACGCGATCATCAGAAATTATACAATGCGTTCTACAACTCCATGAAGGATATTTTAGATGAAGCGGAGAAATTTGGAGT
TAAAAGAGAAGAAGCTTGTCATAACTTTGTTTTCCTTGCAGCCTGCAGGATTCAATTCATATGGCCGTTTGAAAGTGTTCTATCCATCTT
TGATCAAATGTATCGGAGCATCAGGACCTAGTTTACATACTAGGCTCGTTAAAGAAATCAGGACCGCAGTTAAAGAAGCAGGAGGGGTAA
CTCTTTCAGCCTGCAGGATTCAATTCATATGGCCGTTTGAAAGTGTTCTATCCATCTTTGATCAAATGTATCGGAGCATCAGGACCTAGT
TTACATACTAGGCTCGTTAAAGAAATCAGGACCGCAGTTAAAGAAGCAGGAGGGGTAACTCTTTCAGGCTTCAATTCATATGGCGGTTTG
AAAGTGTTCTATCCATCTTTGATCAAATGTATCGGAGCATCAGG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
aos3 allene oxide syntase allene oxide syntase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E595784
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None