Unigene SGN-U290576

Unigene Basic Information 
Unigene ID: SGN-U290576
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 290576
mRNA sequence: Length: 315 bp

>SGN-U290576 Solanum tuberosum #4 (1 members)
TGAAAAGAATGTTTGGCCAGCAATTGCAGCAGGCAAGGTGAAACCAGTGGTGTACAAGTACTTCCCCTTAGCAGAAGCTGCTGAGGCTCA
CCAGTTAATGGAAAGCAGCAAGCACATTGGAAAGATTCTGCTTACTGTTTAAATGTTGTAAAAGAGAGATTTTCTTGTTCCTAGTGTTAA
AATTGCCTGTACTCCCAGCCAGTCANACCCCCAAACCTCTGCTGCATGTATTATACTTTGCAAAGTTCCAATAAAACAAAACCTTTTTAT
GATTTTTTTTCATTTTTTTGTTTGCGTAAAATAAACAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ191658 NADPH quinone oxidoreductase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E614390
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None