Unigene SGN-U290873

Unigene Basic Information 
Unigene ID: SGN-U290873
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 290873
mRNA sequence: Length: 732 bp

>SGN-U290873 Solanum tuberosum #4 (1 members)
TTATTTTTATGCAAATCTATCACTTGTCTTTCACCATCAAGAAATAATACAGAGTATGCATGCACTTACATATAAAGTGAAAAATCTCTA
AACAGTTAGAATGAATAATCAGTGCTTCTTAAACAAGAGGAATCCAACGACACCAACTGCTAATGCTAAGGTGAGAACACTAATCATTCT
TGTTTGTCCAAACTGTTCTCCTGGTCTCTCGCTGATAGCAACGCAAACTTGACGCTGCTCGAAACCAATTTCGGACATCAAATTGGTCAA
GCGGTCAGAGACATTCTTCATATCTGGGCGTGCATTTGGATCCTCATCCAGACATTCTGTTGCTAGTTTTGTGATTCCACAAGCGAGCAC
ACCATCACAATTTAGCAGAACTGATTTATCCACTATCGATCCTTTACCACCTTGTAGCTCCTCCCGAATCCAACAATGATATGGACCTTC
AATGTTTTTGTTATTGGTAATCAACCTCAAAAGTAGAATTTGGATTCTTTGTCCAAGCTATTGTCACCGGAAAGGGTCCATTGGAGAACC
TTGCCGACCACCTTGCTGACCCAGGTTAACAACAACGCCTGGGCCTTTGCCACAAACTTTGTTCCCGGAAAGTGAGCTTAACAATATGTT
GATCTCTAATCTCCAATTAGTGTGAGATTATGAGTTTTTAGCTTTGTGAGAGATGAATCTATAGAAGGGGTCAGTTTTTTAAAAGCATTC
TGGGTTATGGGT


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
lhcb1 chlorophyll a/b binding protein chlorophyll binding
osm8e osmotin (OSM-8e) gene
Z13987 chlorophyll a/b-binding protein PS 2 type 1chlorophyll binding
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E612426
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None