Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Unigene SGN-U291753

Unigene Basic Information 
Unigene ID: SGN-U291753
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 291753
mRNA sequence: Length: 1466 bp

>SGN-U291753 Solanum tuberosum #4 (1 members)
ATAGAACAAGGCATAACCGACCGGCGATTCGAGAACCGGTGAAACCGAGAGTACCACTGAGACTATTGTTCCGAGTAGCTTCGGTTGCCG
GTGGAATTCAATTCGGTTGGGCGTTACAACTATCACTGCTCACACCTTATGTGCAAGAGCTTGGAATACCGCATGCTTGGGCGAGCATAA
TATGGCTCTGTGGACCGCTTTCAGGTTTACTGGTTCAGCCTTTAGTAGGTCACATGAGTGACAAGTGCACAAGTCGGTTCGGTCGTCGGC
GCCCGTTTATTGTCGCCGGAGCAGTATCGATCATGATTGCGGTGTTGATTATCGGTTTCTCCGCTGATATTGGATGGCTTTTAGGTGATC
GAGGTGAAATAAAAGTGCGTGCTATAGCGGCGTTTGTCGTAGGGTTTTGGCTTCTCGATGTTGCCAATAATATGACTCAAGGACCTTGCA
GAGCTCTGCTTGCTGATCTTACACAAAAGGATCATAGAAGAACCCGGGTAGCAAATGCATATTTTTCCTTATTTATGGCCATTGGTAACA
TCCTTGGCTTTGCTACTGGATCTTACAGTGGCTGGTTCAAGATCTTCCCTTTTACTCTCAATACTGCATGCACCATCAACTGTGCCAATC
TAAAGGCTGCTTTTATTATCGACATTATTTTTATTGCAACAACTACATGCATTAGCATATCAGCGGCCAATGAGCAGCCTCTAGATCCCA
GTCGTGGTTCCTCTCATACCAGAGAAGAGATTGGCGAATCAAGCCATGGTCAAGAAGAAGCTTTTCTCTGGGAGTTGTTTGGAATTTTCA
AGTATTTCCCAGGTGTTGTTTGGGTGATCCTGCTTGTCACTGCCCTGACATGGATTGGATGGTTTCCGTTTCTTTTGTTCGATACTGACT
GGTTTGGTCGAGAAATTTATGGCGGTGAACCAAATGATGGAAAGAATTATAGTGCAGGAGTGCGAATGGGTTCATTGGGTCTAATGTTGA
ATTCTGTGCTTCTTGGACTAACTTCATTGTTCATGGAGAAGCTCTGTCGAAAATGGGGTGCTGGTTTCACATGGGGAGTTTCAAACGTGG
TCATGTCTCTCTGTTTTATAGCCATGCTTATAATTACTGCTGTTAGGAGTAACATAGACATTGGCCAGGGTCTTCCACCGGATGGCATTG
TGATTGCTGCGCTGGTTGTATTTTCTATTCTTGGGATCCCACTAGCTATAACATACAGTGTTCCATATGCTTTAGTATCCTCAAGGATTG
ATGCTCTTGGGCTTGGACAAGGCTTGTCAATGGGTGTGCTGAACCTGGCAATTGTGTTCCCACAGATTGTGGTTTCTCTGGGAAGTGGGC
CATGGGATGAGTTATTTGGTGGAGGCAATTCACCAGCCTTTGTTGTGGCTGCGCTTTCAGCATTTGCTGGTGGACTTATAGCCATCTTGG
CGATTCCTCGAACACGGGTTGAGAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
sut4 sucrose transporter 4sucrose transporter
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E624518
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None