Unigene SGN-U292429

Unigene Basic Information 
Unigene ID: SGN-U292429
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 292429
mRNA sequence: Length: 333 bp

>SGN-U292429 Solanum tuberosum #4 (1 members)
CTGTGCATTGTACCTGTGTTCCACCAGGTAAGCAACTCAACCGCGGCCCATGGCCCTCCAGGGTTCGATTTCCTTGCCCTTTATGTCGGA
CACCGGCATTGTTTCATTCGTTAAGGCTGGCGGATACGATGCCAATCATCAAGGAAGCAGCGCGAACGAGTCTATCGTTGCCTTTTTGTT
CCTGTACAGCTGATGGACAAGAAGCAAATTCATTAGAAACACCTTTATGCAAGCCTGATTTATATTTGCTCGCGACTCTCCCTCTCGGTC
TTACCTTCCGGTCCGTTAAGCTGGCAAAAGGTCCCGGGCATTGAAATTCAAGCCAAGGGCTTT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
Star Solanum tubersum ankyrin repeatE3 ubiquitin protein ligase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E621882
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (3)  
Preceding Unigenes (0)None