Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

Unigene SGN-U292499

Unigene Basic Information 
Unigene ID: SGN-U292499
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 292499
mRNA sequence: Length: 802 bp

>SGN-U292499 Solanum tuberosum #4 (1 members)
TAACATTTGGGGATTTGGTTCAAGGAAAGTGTAGACAGATTTGAGCTTTGAGGAATTGATAATGGTGGGTGCATCACTGGCAGGGTTGCA
AGATCATCTCAAATTGGCTAGAGAATATGCTGTTGAAGGCCTTTATGATACTTCCGTCATCTTCTTCGATGGCGCAATTGCTCAGATCAA
TAAACACGTAAACACACTTGATGATCCTTTGATTCGTTCAAAATGGATGAATGCAAAGAAATCAATTTCCGAAGAAACTGAGGTAGTGAA
ACAATTGGATGCCGAGAAAAGGGCTTTTAAGGAGATTCCTATGGGTAGGCGTCCTAATTCACCTCCCATTTCAACCAAGTCGTCTTTTGT
CTTTCAACCGCTTGATGAGTACCCCACCTCATCCGGTGCTCCAATGGATGACCCTGATGTTTGGAGACCACCAAGTCGGGACACAACAAG
AAGACCTGGAAGAGCCGGTCAAGGGGGTATGAGAAAGTCCCCACAAGATGGAGCGTGGGCTCGTGCATCTACTACAAGGACTGGAACCAC
AAGCCGTGGGGGAAGGACCAGTGGCTCTACTAAAGCTGCTACTGGGATTCGATCTTCAACTACTGGGAAAAGAGCACCTGGAAAATCTGC
AAAATCCGATTCTACGGATGGTGAACCTGAAGAGGGGAAGAGTAAAACAGGTCAGTACGATGGGCCTGATGCAGACCTGGCTGCTATGCT
TGAGAGAGATGTCTTGGATACTACCCTGGTGTGAGATGGGACGATGTTGCTGGGTTAAGTGAAGCCAAAAGACTTTTGGAGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E461532
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (1)