Unigene SGN-U292968

Unigene Basic Information 
Unigene ID: SGN-U292968
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 292968
mRNA sequence: Length: 528 bp

>SGN-U292968 Solanum tuberosum #4 (1 members)
GAGAGAGAGAACTAGTCTTCAGTCTTATACACCAAATAGGAGGAATGAAAAACATATTTCTTGTAGATTTTGACAATGATGGCAATAACA
TTCTACATTTGGCTGGGAAGTTAGGGGAGCCAATATTCAGTAAACAGAAAAGTAGTGGACAGATGGAAGCCCTGAAAAACAAACTTGTTC
AGTCTGTGCCTCCTAATGCTGATAATAATAATAATGCTGTATTCGTTGAATCACTACAACAGCTGTTTCAAGAGATAGAAATCATTAGAC
ACATAACAGAGACACAGTCTGTTAAGGCGGAAGAGAAGATTATGCCGCCATCATTTCTTAGGGTTTCTGGAGCAGCACTTCAGATGCAAA
GAGAGATATTGTGGTTCAAGGAAGTGGAGAAACTTATACCACCTTCAGGCCGCAAGAGGAGAAACAAGGATGGGAAAACCCCTAGAGAAT
TATTCACGGAAGAACACAAGATATTACTAAAAGATGGGGAAAAGTGGATGAAAGACACCGCAAATTCTTGTATGATTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E476676
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (5)  
Preceding Unigenes (1)