Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U294574

Unigene Basic Information 
Unigene ID: SGN-U294574
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 294574
mRNA sequence: Length: 608 bp

>SGN-U294574 Solanum tuberosum #4 (1 members)
CCGCATTCGACTCCTAGTTGTAGGAGAAGCAATGAGAGGAAGACCTAGTTGAATGTGCCACATGTCTGAAACACGCTTCTGCATTGATAA
ACAAGATGACTTAACAGGTCTCTCAGATATAGAACGAATCCATCACACAGCTATACCACGAACCTCCTTCATTTGTTCCTCCATTGTTGG
ATTTCCCATCTCAGGTGACAACACGTATCAAAAAAATCAAAACTACGACCTCCTGCCACCGGCCTCATCACTCCCATTGACGCCAACACC
ACTCTTCGCTGTTCCATAAGCTGCCCCCATACCTATGATATTCAAAACAAAATCAAATTTGTGATCAGTTGCAAATAAGCATAAGATGAG
CTCAGGCGATTCACATAAGACGTGCTCATATCTCCAGCAAAGACAGATCACATATTTAAAGCTTATAGATGCAAAATCTCATTGTCTTGG
ATGGTCATAACTCATCACAGGCAGGGCCGTCTTGATCATAAGGCTACTAAAGCGATCGCTTGGGGCCCCCATTTTCTTCCAAAGATGTAT
ATATATGTGGATATATATCGTTAAAGAAAATTCATGTATTGATAAATTTGAAAAGAATTTTGCGTATA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ191632 vacuolar proton ATPase proteolipid
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E592716
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None