Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U294589

Unigene Basic Information 
Unigene ID: SGN-U294589
Unigene Build: Solanum tuberosum #4
Date: 2005-05-04
Organism: S.tuberosum
Alternative ID: 294589
mRNA sequence: Length: 2846 bp

>SGN-U294589 Solanum tuberosum #4 (1 members)
TTTTTTTTTTTTTTTTTTTTTTAGAGTTATGGGAGATAATAGAGGACTTGGTGTTTTGGGTGTTTCAATGTGTGGTGCAGCACAAGAAAT
AGAACAATTATCAAGAGAAAGTAGTCATTATAGTCTTTCTACTGGAATTTTGCCTTCACTTGGTGCAAGAAGTAATAGAAGAGTCAAGCT
TAAAAGATTTATTATTTCACCTTATGATCGACAATACAGGTTATGGGAGACATTTCTAATTGTGCTGGTTGTTTACACTGCTTGGGTGTC
CCCGTTCGAGTTTGGCTTTCTAGGAAAACCAGAAGGACCACTCGCTAAGACGGACAATGTAGTCAATGGATTCTTCGCGATTGATATCAT
TCTTACCTTCTTTGTAGCTTTCTTGGATAGAGCCACTTATCTACTTGTCGATGAACACAAAAAGATTGCTTGGAAGTATATGAGTACTTG
GTTCTTATTTGATGTCATATCAACAATCCCTTCAGAACTTGCTGTGAAGATTTCCCCAAAACCTTTACGTCAGTATGGATTATTCAATAT
GCTTCGTTTGTGGCGTCTAAGAAGAGTTAGTTCATTGTTTGCCAGATTGGAGAAAGATAGGAACTTCAATTACTTTTGGGTTCGATGTGC
AAAGCTTGTTTGTGTCACTCTTTTTGCTGTTCATTGTGCCGGATGCTTTTATTATCTTATCGCGGCCCATTATCCTGATCCCAAGAAGAC
ATGGATTGGGGCCTCTATGGATGACTTCCTTAATCAGAGCTTATGGATTCGTTATATCACTTCTATTTATTGGTCGATAACTACTCTCAC
TACAGTCGGTTATGGAGATCTGCATCCAGAGAATACGCGGGAAATGATCTTTGATATCTTCTACATGCTCTTTAACTTGGGATTGACAGC
ATACTTAATAGGAAATATGACTAACTTGGTTGTACACGGGACGAGTAGGACTAGAAAATTTAGAGATACAATTCAAGCTGCTTCGAGCTT
TGCACAGAGGAACCAATTGCCTGCTCGTCTCCAAGATCAGATGCTTGCACACTTGTGCTTGAAGTTCAGAACAGACTCAGAAGGGCTGCA
GCAGCAAGAGACACTCGAGTCTCTTCCTAAAGCCATCCGTTCAAGTGTTTCACATTTTCTTTTCTACTCTTTAGTAGATAAGGTTTACCT
GTTTCGTGGAGTGTCAAACGATCTACTCTTCCAGCTGGTCTCCGAGATGAAGGCAGAGTACTTTCCTCCCAAAGAGGATGTCATTTTGCA
GAATGAAGCACCAACAGACTTCTATATTCTTGTAACAGGAGCTGTGGATCTAGTGGTTCTTAAAAACGGAGTTGAACAGGTTGTCGGGGA
GGTCAGGGCAGGTGATCTTTGTGGTGAAATCGGGGTTCTTTGTTATAGGCCTCAACTATTTACAGTACGAACGAAGAGACTGTGCCAGCT
ACTACGTATGAATCGTACCACATTTCTGAATATCGTCCAGGCCAATGTTGGGGACGGGACAATAATCATGAGTAATCTCCTTCAGCATTT
GAAGGAAATGAAGAATCCAATTATGGAGGGTGTTCTACTTGAGACCGAGCATATGCTAGCTCGCGGTAGAATGGACTTGCCTCTCACCCT
TTGCTTTGCAACACTTAGAAGTGATGACTTATTGTTGCATCACTTGTTGAAACGCGGTCTTGATCCAAATGAAGCAGATAACAATGGAAG
ATCCGCGTTGCATATCGCTGCGTCTAAAGGCATTGAGAACTGTGTGGTTCTTCTGCTCGATTTCGGGGCTGATCCCAATAGTAGAGATTC
AGAAGGCAATGTGCCATTGTGGGAGGCTATCATGGGGAAGCACGAGTCAGTTATCCAGTTACTCGTTAACAACGGTGCTAAACTATCAGC
TGGTGATGTGGGACATTTCGCCTGCGTTGCTGTTGAACAAAACAACTTGAGTTTGCTCAAGGAGATTGTCCGTTATGGCGGGGATGTCAC
GCTTCCCAAGATCAATGGTTCATCAGCTCTCCATGTTGCTGTTTGTGAAGGTAACATAGAAATAGTAAAGTATCTCTTGGATCGAGGGGC
TAACGTTGATCAACCAGACGAACATAATTGGACCCCCCGGGACCTTGCTGAGCAACAAGGACATGAAGACATCAAAGAACTCTTTGAATC
CAGGGTAATGATGAGAACTCGATCCGTTGATCCTATCCCCGAGGAACGATGTAGATTTCTTGGGAGGTTCAAAAGTGAACCAACAATCAC
CCCTGCATCCCATGGAGTCTCATTTCTAGGACTAGACGGATCATTAGGGCGTTCACGTCCTAGACGTAGGTCTAATAACTTCCACAACTC
ATTATTCGGGATAATGTCAGCAAAGCAGACCAATGAGCACGACCTTTTATCTGCAAACGACAGTAATGTAAGTGTCATGACAACCAAGAC
TTATGCTCCCCGAGTGACAGTGTGTTGCCCTGAGAAAGGAGACAACGGGGGAAAACTCATTTTACTCCCACAGAGTTTTAAAGAGCTACT
TCAAATTGGTTCTAGTAGATATGGTATCTCTCAGGCCAAAGTTGTAAGCAAAGATGGAGCTGAAATCGACGAAATAGAGTTGATCAGAGA
TGGTGATCGTTTAGTTTTTGTTAGCGATAAAGATAACAATATTGATGAAGCTAAATCATCAGAATTGTAGTGAGTTTAGGTGAAAACCAA
AATTGTTCTTTATTTTTGTAGTTAATTGAGTGTAAACTAATTCACAGCCCATTTGTGGAACATGTAAAGCTCAGAATGAGAAAATATATG
TACATTCAGTTACCTCTTTTTTTCTAATATACGAATATTGATAGTTCAGAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
skt1 potassium channel genepotassium uptake
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E624085
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 3 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None